Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C48E7.9   

sjj_C48E7.9RNAiJA:C48E7.9
PCR_productsjj_C48E7.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC48E7.9 Source_evidenceePCR728WS150 Sequence/Annotation Release
Overlaps_Gene C48E7.9 Source_evidenceePCR728WS150 Sequence/Annotation Release
Chunk_score Abs_score602
Max_abs_score602C48E7.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI62699456271096
Overlaps_transcriptC48E7.9 Source_evidenceePCR728WS150 Sequence/Annotation Release
WB_DNA_textsjj_C48E7.91152aagccccaaaatgtgacaagaagaataaaagctttcagtactgtcatcttatactttgccgactttttgccactgaaaactaaataatgaactcaaataaagattttatatggaaagttgagaagaggttatttatgtttaaatgttaaattaccattttcgaacgcaaattgcaaaaattttgagtgtcaaattgcatattttcaacgttatttttccattgttgcgaagtacgtagagtgttagagcaattcctataataccataagctacagtaaccaatttaccggcaattgtgtgacagacaagttcgccgtaccctgaaatagaaaatagaatgattagacgacacctcgggagaaaattttaaaaatatttttcaaaatgttcgaaatcagttttgatactattttacttgttaatcccgagtcatacctattgtcgtaatacaagtgattacataagccagcccatccagaaactcttctatatgctttggagggtttgaagcgtagagtaggtcaaaaatttcttttatacaattgttgttcaactcattatctgcctgaaatagatgaaaattgtatcgaggcgttttccgggtatgctcaattgaaagagatgcagaaatactttcacaaacctttttcaattttccacacttgctacctttcattgaattgtagatgtgtattgatttctgacgaatatttcttttgaactcattaatctgaaaatattatcaatgaatatatatctgcaacagaaacaaaagctttacaaacattcatatcagatctcgattcaatctgccaaaacaagagagctccaccaattatatatgcaacaagaaccacaaatgcaattattgtattaaattctgaaatttgaaacattactttaagcagaatataaaccaaatcctcacttcgaatctttctcaaaattgttcgtaatttcgttggcttcggtctttccgctctagactttcgttcaacaaattttaaaatagattgctttctgacaagatgttgagtttctggtgaagatttttccatttgcctctttataaatttattaataagtcgatccgtgtgagtttgcattccatcgctgaaagactattgcagtttggattgacagtggtgaagc