Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C49A1.3   

sjj_C49A1.3RNAiJA:C49A1.3
PCR_productsjj_C49A1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC49A1.3 Source_evidenceePCR720WS150 Sequence/Annotation Release
Overlaps_Gene C49A1.3 Source_evidenceePCR720WS150 Sequence/Annotation Release
Chunk_score Abs_score636
Max_abs_score636C49A1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1421838014220013
Overlaps_transcriptC49A1.3 Source_evidenceePCR720WS150 Sequence/Annotation Release
WB_DNA_textsjj_C49A1.31634tccaaatgttgtcttgtgaacagacaaataaagaagtacaatctgaccgaaaagatgacaatctgcgagtatgccaggggaatcggagtggtgtcataggtggaaagagtcgctgttttttcatgaaactccgtaatctctgcgtacacagtgtcatatacaccagtcccaccaaattcctcctgaaaagttaaatttcaaaaagtctacttttcggtaagcttaccctgggattgtccgccttgaacgtcctctcctctgcctcttcatatttctgcagtattttcagcgcccagatgattggaacaaacgactccgcgtacaccgcacatggcactttttccagttttttccgctcggtttcatgcaaaagtccggcggtgaccagcgcatcattattcgggaatcgcttcttcaccagtgcagatatttgtcggatgccgagaatttgcgataaaaccatataacgaatgatgttacgccggttatgaatgttcacaactcccgggatgaaggcggcaactgatagagcaactctgaaaaattaccaaaaaggttattttcagttcaagcttgataactttgctgaaaatagtcgtatcaaaaaattttcaactaacaatttgtaggaaatttcattttacacatcttgttggtttacaacttttttctatctctcctctccgcagagatacaaagctttaaattcgagatgacgagagtgtgtgaaggagagggagacgcagcgcgctctcgtcgtctctcccctcccctccctccacgctcttttgcgcgctaacttcaaacgcttgtaactccgcgcacataggagctattgaaaatttttcaactaacaaaataaagtacataaaatttcctacaatttattagtaataactttttgataacgttactctctacaaagttatggaggtttgagcttccctctatttagagccaaaaatctggggttttcgtaataaaaaagcttaaatttttcctttaaattttaacttggttagtcaaattttattaaatagcgtttttcaagcaaacattctaaaaaatactgacagaaaaaatttcaacttcaaagctatataactccgccgagataaaagatagaaaaaaaaaattttgactgacaaattgtagaaaatttcattttacacattttgttagtttacaaattttttctatctctcctctccgcagagatacagagatttaaagtctagattacgatagagagagagagcgtggaggagggggagacgcagcgctatgtaactttgcggagaggtgagctagaaaaaagttgtcaactaacaaaatgtagagaattttgcgtggaactcacttctcaatatagctaacattttcgaacgactctccccaccgctcgccaaccattccgataaagtatccgagcatgaattgcattggaacgcagacattatgtttatcctgtagatctctgataaatgaggagaaaattctggaaattagaaattaattgtcgtaagttatcgttctctccttactcttgttgttccgccgacaaataaaatctatagatgcctgcgatgcataaataaattagataccaagtgccaacttcatcgagaataatt