Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C50C10.1   

sjj_C50C10.1RNAiJA:C50C10.1
PCR_productsjj_C50C10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC50C10.1 Source_evidenceePCR721WS150 Sequence/Annotation Release
Overlaps_Gene C50C10.1 Source_evidenceePCR721WS150 Sequence/Annotation Release
Chunk_score Abs_score638
Max_abs_score638C50C10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV98079759808902
Overlaps_transcriptC50C10.1 Source_evidenceePCR721WS150 Sequence/Annotation Release
WB_DNA_textsjj_C50C10.1928tggctccaaaacaattcctccccaattcttttctatcctggtgttattgttcggtgatctatttttgagatgtctgtctatggatttaaggcgatcgattttcaaccggaatatttcaattttgaatacacattcaattttttgactatttttgctgctgtcacagctatctacggtattttttcgttttggatcactgtgaaaatgtgtattttctatttgaaacataaacattgcaacgaaatgaaaaaagtattgagaccggatgtttttagaatatttcttttgatgcaactgtggaaagaatttcatgttttcattgattttttaattgttcgaattccattgacatcgattttcacagcgtattgtgcagagtcaaaacctgtattaattcttaaaatattatctttactatttattggagttgtttatacatctcatttaatgactctggcattttgtgttcaaagagttgcacttttgtatgctgctgagtatcaaaaggatgtatgttttgcacggtccatttttaaaaataataaaaagacatttagacaatatccaaggtgtttgacataatcgctccaagtcttataataattggtcattgcttcggaattcctcatttcttttccacaacttcctgctatcaaatggacaaaccttttccgtttggagctattgttatcacggcattgacaagagatatggtaagcatttgatttgataaaacgcttaaattataaatttttcagagaatttacacaatattctactcaatgttttcaaacgcttcgattattttaattattgtcactgcaattttgatgttcttcaaacttttgcaaaaacggaaaatgttagtgtcaattgcatttgctcaagttaaaattttaaaatttcagaagttccgagctacaccgaa