Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C50F4.7   

sjj_C50F4.7 RNAi JA:C50F4.7
Simmer:C50F4.7:Repeat_a
Simmer:C50F4.7:Screen
PCR_productsjj_C50F4.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC50F4.7 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene C50F4.14 Source_evidenceePCR45WS150 Sequence/Annotation Release
C50F4.7 Source_evidenceePCR448WS150 Sequence/Annotation Release
Chunk_score Abs_score385
Max_abs_score385C50F4.7
Specificity_index0.812
Rel_score1
Map_statusUnique_ePCRV95495459550260
F17E9.12 Chunk_score Abs_score89
Specificity_index0.188
Rel_score0.231
Overlaps_transcript C50F4.14 Source_evidenceePCR45WS150 Sequence/Annotation Release
C50F4.7 Source_evidenceePCR448WS150 Sequence/Annotation Release
WB_DNA_textsjj_C50F4.7716ccaagtttttgacgtatttttcgtttctgtgacgcttttctgacatgtgtccccgcagggtggttcaatctgactccacccatttctgctggcgtataaaagaacgacgacgagtgacgttcaattctgtttttatcaactcattcgctttcgttttctaacaacttttaatcatgtctggacgtggaaagggaggaaaaggacttggaaagggaggtgctaaacggcatcgtaaagttcttcgtgacaacatccagggaatcacaaaggttagttttttgaaaataaatatatatttttaacttaaaaatattttatctaattttcaatatttactttccagccagcaattcgccgtctcgctcgtcgtggtggagtcaaacgtatctctggacttatctacgaggaaactcgtggagttctgaaggtcttccttgaaaatgtcattcgtgatgctgtcacttactgtgagcacgccaaaagaaagactgtaaccgcgatggacgttgtctatgccttgaaacgtcaaggaagaactctctacggattcggtggataattcactcggctgagccgaggttactgtaaatatatatcatgaaaaccagatcactcgctttgaaattcaataaaatattatccgacttaattttgatgttcttcagaaacaatttataaatcgatctatacattataagcagtggctaccaaccata