Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C51F7.2   

sjj_C51F7.2RNAiJA:C51F7.2
PCR_productsjj_C51F7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC51F7.2 Source_evidenceePCR839WS150 Sequence/Annotation Release
Overlaps_Gene C51F7.2 Source_evidenceePCR839WS150 Sequence/Annotation Release
Chunk_score Abs_score734
Max_abs_score734C51F7.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1231011712311224
Overlaps_transcriptC51F7.2 Source_evidenceePCR839WS150 Sequence/Annotation Release
WB_DNA_textsjj_C51F7.21108ttatggtattccatccgtagcactttatatcacaacttgcatagttattatcaaaaacaataaattatttgattcatcgttttaccaaatttttatgtttgacggatttatgaacattttcacctacataatgggactcgtcttcatgcgacttaccagtataacgtgttataactgtttgatggcaccaattttcagacacataggttagttccacggtgaaaaatttcgtgcatatactactgaaacctagctaaaaaaaatacttgattttaaacgaccggtagtagatttcataaaatttagtttccaggtaattttttgcccttaacatttatgggtacaatggcttatcatatggcatatgttcaatacgctttaacaactcttgtttctttgaatcggttgacagtattgtttaagtataacattttcgaaccggtaaatcaatctacgacgaattcaaagacacaaatagaatttcagatttggaaaaaaattacatggttatttattctagttgcttattttgttccctttctcaacactcatattatttttcaaaataaattcacaattgactatctcaacgaaagcgactcttacacattgcaaaccccaaatatggtgggcggaaacttttacaaaacaaaaaaaaataaaaataaataaataaataacttgattgaggtttcagccattcatagaaatttacaatgtattaattccatttatgtgcatttgtatggcaatttcaattctttccaatactacaagtgtcatatttttacgaaatctgaatattcaaagaaaaaaagcggaaacaaactttttactcataatgtctataacatgtttagtccaacttattggaacaataatttctattgctttattgaagtgcaactattgttctatgttatcatatcttacaatggttctaccatttgttagtgacggtttatctttggtgcaaccttggctgttgatttgttttagtaaaactgtgagggttgaaatatagtctcaagaatgttatatcctgattttcagatgagaaaagaaattttgatattgtttggtataaaacctaaagcaacgattctcc