Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C51G7.h   

sjj_C51G7.hRNAiJA:C51G7.h
PCR_productsjj_C51G7.h
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y79H2A.1 Source_evidenceePCR144WS150 Sequence/Annotation Release
Chunk_score Abs_score123
Max_abs_score123Y79H2A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1202259912023548
Overlaps_transcript Y79H2A.1b.1 Source_evidenceePCR144WS150 Sequence/Annotation Release
Y79H2A.1a.2 Source_evidenceePCR144WS150 Sequence/Annotation Release
Y79H2A.1b.2 Source_evidenceePCR144WS150 Sequence/Annotation Release
Y79H2A.1a.1 Source_evidenceePCR144WS150 Sequence/Annotation Release
WB_DNA_textsjj_C51G7.h950aatttttcgtcgtatttggatcaggggtgggcggcaattgcagttcggcaaattttttttgagtaaattggcaactgaaaatcggcaatttgccggttagccgatttgccggaaacttttgattccggcaacttgtcggttttccgggaatttccaattccggtaatttgccgattcgcctgaaattttcaattccgacagttttccgatttgcctgaaattatcaattccggcattttgcagatttgccggaaattgtaaattttggcaatttgccgatttgccggaaatgttcaattccggcaatttttagatttgcctgaaattatgaattccggcagttcgccggtttgccggaaattttccattccggcagtttgtcgatttgccggaaattttcaattccggaaatttgtcaatttgcatgaaatttttaattccggcaatttgcctgaaattatcaattccggcagtttgtcgatttgccggaaatttttaatatcggcaatttgctgatgtgccggaagttatcaattcctgcaatttgccgatttgcctgaaattttcaattccggcagtttgtcgacttgccggaaatttcagttccggcacttcgccggtgtgccggaaaatcttaattccggcaacttgccgataagccagagattgtgaattccggcaattcgccggcttgccgaaaaaaatcgtttgccgcccacctctgttttttgcttagttttcgggatctgaaaccgataaaaattttcactattttttttgtcaaaaaaccatcaaaaaaattccagcaaccaccccaacaattcttcttcccatcccaacaacaacagcagcatcagcagcaaccacaacagacccaacaacctgaggaccgtttcccacaggctccacaattcttccaaccaatcccacaaccatcagttcacgataag