Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C53B4.5   

sjj_C53B4.5 RNAi JA:C53B4.5
[cgc5655]:C53B4.5
PCR_productsjj_C53B4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC53B4.5 Source_evidenceePCR804WS150 Sequence/Annotation Release
Overlaps_Gene (10)
Overlaps_transcriptC53B4.5 Source_evidenceePCR907WS150 Sequence/Annotation Release
WB_DNA_textsjj_C53B4.5950aaccggttttctgatcgttgaacagttaaaaaatgagattttttcgaacggaaaatattttattcaaataagaacactttcaattcgagcttttgttatgcatatgaaaaaggaaaatggaaaagatgagaaaagaaaactcgtttttaacgacgggatccatcctcgaagaagactccaccatcgagagcacagtattttggacagactcccttctctcctggatgtccatcgcgtcctggctgtcctggacgtcctggttgtccgtctcttcctggttgtcctggttctccgttggctcccttctctcctggtcctccttgagctccatcctttcctggttgtccagctggtccgcgggatcctggttgtcctggacgtcctggctctcctggtgatcctggttgtggctctccattgcgtccattctctcctggtggtccagctggtcctggctttcctcctggtcctggtggtccagctggtcccttgtttcctgcagttccatttggtccttctggtcctggtggtcctggtggtccgagtggtcccttgtttccttgtggtcctggtggtccggctggtcctggtggtccttctgggcatggcttgcatggtggtggggtgattggctcacatggctcctttggtgggcgtcctggatttccgttaagacctggtgctcctggctttcctggtcgtccagcacgtcctggggttcctggtggtccttgtgctcctggaagacagcatccctcgcattgtccatttccaacttgacgggcggtacggttgtgagccatcaccatatctgggactctgttgacgtccccccaaagcttcttggcctcagcacggcactcgacaatatcatgatgcatggtcttacgagcatgatgaatgtaattgtataccattggaagagtaatacagaccgaaagaacggctac