Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C53D5.a   

sjj_C53D5.a RNAi JA:C53D5.a
Simmer:C53D5.a:Screen_A
Simmer:C53D5.a:Screen_B
PCR_productsjj_C53D5.a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC53D5.6 Source_evidenceePCR2320WS150 Sequence/Annotation Release
Overlaps_Gene C53D5.6 Source_evidenceePCR2320WS150 Sequence/Annotation Release
Chunk_score Abs_score2257
Max_abs_score2257C53D5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI311632314097
Overlaps_transcriptC53D5.6 Source_evidenceePCR2320WS150 Sequence/Annotation Release
WB_DNA_textsjj_C53D5.a2466tacaaacaaggaagattctcggaagattctgattttctggtccaaaaagtgcggcgtcttgtttatcaaacaattcggcgagacacgtgtaaatgtaggggctttcctcggtgtctgaatatgttggcaaccagctcaggaacatctcgacgacctggaaataatatggaacttttttcttgaaaaactgaattctaaaaccaacctttccgtaggcttcagcaggaagtggcacattgccgatgattttggcaaatgcagaaatcgcgttttccgtggcaacagtgctctcctcggtggctcgggcgtcctctcgttgaatcatggcggccagtggctccaaacagctcaaaatctcgtttcggtagtcgctgatctggtggtagttgatggccataactccgaaaccgtagctcgctgcttgtctcacttcaggatactcatctcccaacaacttgtacattattggaataagcttcgggaagcgagttggcatatgtccgacaccgaactcgatggcgtcatcgagaaggcacattccccattgtctctcgaagtattgtttggatccctcgatgagttgaatggcacagttgaacacgttgatcattccctcgaagatagttcccttgaactccttcataagagagtgagtcaaatcagagatggctccaaggcatgaggcctccaattccatgaaataatcgagctcctccttagcttcagcatcatcgtcatcttcatcttcaactggacgatcgctcattctctttccgtagttttcaagttgcttgagaagcaccgaaatgatgagttgaacctcttcctcggcgattccctcggttttcataacctcaatgcacgatccgatggtcgtcatgaacgaggcgagaatctcgacatcgtcctcctcctccatagaggtcgtcaatgccttcaagaactcgcaccacaaacgacgcttgtcagccaatccttgcttctcaacacaggtcaacaagcatggcatgatttcagcggaagccgtacgaactccgtcgtgaagtccgaaatcgagattcttgatggcgagctcgtagacgtcgacgacgtatggcatgaaagcctccttcatctccttggcgaacgcgacaagcatatcgcaagcagttgccttctcctcaagaccgctggtgcggattccgacagtcttttctcctccgattccgtggtattcaactccttcctcgttttcgtgaacatcttcgtctgaaatttatatatttttttaacacgtaaaactaaaaaacactcactgttgaagatattgaagtctgggcggtaacgagcggcacgaagaactggatccatgacaactgggaggaatggtgcgaaatcggctccaagaatagagcagaaacgagtccatgagctgatcatgtagctgtattgtggatcatcgatagccaaatccttcattccgtctccgagaaggttcaggatctcgattgcagtagcgtggaattgttcctttccgacagcatatccgatgagagagatgcattcgatggtctttcctctcaactccttgagctctccgacgttttgaagaatgtgaacgaggttcgggatgaggcgagcatgatgttccttgaagagctcctcggcggcttcagcgacggaggcgatggcggtgacgatgttctcaacgacaacctggtatctcttgtctccgagacgattgaacacagcggaaagcacattttcgagtttctgaagaatgaatggaagatattgtccaatgatgctctttgggcactcctcggcaaagttgacaagagccgaagcggcatgagcacagacacgtggaacatcggttctgtcaagagactcgagaagagctggtatgacggcggcgtggcacttcttctgaagagttggagcgaagtcagaagacatttgtccgatggcgttgcaagccgcgtattgaactcttggatgagcatcattgacgtaattggtgatatgagccataatttgctctatgtgtggttccatagatctttggcacccttcaccgacggcggagaacgcgcgaagagccgcgtgcttcatcttccagtcttcgctggtcaaaagcttctcgacaagtggaaggaacactgggagcatcacttttccgttgatgcagcaagcaacacggtcgatggcgctttcggcgatgattgggatactgaaaaataatttaattgaagaaaaactaaaaatttatccttactcttcatagtcttcttcctcttcgatctcgttgagccactcattgagcacatcgtcatccatttcggtcatgcatgaaagaagagtctcgagaattggtccaagagctcctggtgcgtatttcttgagtccttttggtgcggattccatgtacgagcaaataacttcgatggcgttctgacggaccatctcgttcttttccttgtttcc