Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C53D5.g   

sjj_C53D5.gRNAiJA:C53D5.g
PCR_productsjj_C53D5.g
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC53D5.2 Source_evidenceePCR739WS150 Sequence/Annotation Release
Overlaps_Gene C53D5.2 Source_evidenceePCR739WS150 Sequence/Annotation Release
Chunk_score Abs_score613
Max_abs_score613C53D5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI283166285908
Overlaps_transcriptC53D5.2 Source_evidenceePCR739WS150 Sequence/Annotation Release
WB_DNA_textsjj_C53D5.g2743ttttgctgaaaatttctgtccatagttatttagagttctgaaaaaaaagattttcgagaaatgattttctaggccaccagaaaagtttctaggccattatcccttcttgatcctttatcattatgattatgatattttttaaacgattttttaggccaccagagggaattctagtccgtgtcaaaaaaaaaagaaagggggtattctttccacataaaaatcccgttggccttttcaatcaaatttcttcaatttttcgcataaaacttacctcccgctgtgacaagcctcctcccgtctcccagtattctcaattcattaatcatcacccccaatgccctcatcaactacagtatccctgcaatccgcgtctgcaaatatgtgccgaatatgtcatacttctacgtcaacgcggtcaaatccgctcatctcaccgtgtcgatgctctggaacactgctctttgtgcataaggcgtgtgttgtggtgagctctttttttgtaaaattcaaaataataattaaaaaatttaaaaaaaaaccttttgtggaatttgcaatttttataaaatcgttaaaaaccaaattcaatttatacaaatttccacattttccaaaataaaaagaaatagccatgcccacaaaatgggcggcgctttcatagccacgtccattttgtgggcggagcctcggatcaaagttttttcaaaaacttactataagttgaacacggatttctggcttccttcataaatcgaaatggcagagtttgccgaactaggccattttgggtcggagagattttgtgtagatttacggcgtgttgcgtgtcgcgtcgcggctcgtttttagttgtaaaactgctgtatttgtccgtgtggagtacacgattttttccacgcgctgtccggcaggcgattgtcaatgaggagcgaaaattcaatgcgaaaggccagaagcccgtggttgaagtgtggtttcaatattacagaaattttaaagaggaataaacatgcctgcctacaaaatgggcggagcgttggaggcgtggtctaagaagtcacgcccttttttttaaatacttgttctgatgtacaatagagcgcatttacatcaaattaataatttgtttttcaatttttccagagatggctggaaatgtcgactcgaaaaatggtcccatcaccacgttgcgaactatgcggctacgattatcgacgtggaaatatatttcaaatgaaatctttacatgttccacacgtggatcgatcatcttgtctgctcaatgtgctctttttgattaccgtattaattatgatattttgtggatattttacgattcaattcattcaggagaatgcactcttaaaacgaaggtgggcgaagttttctggtgatgacctaggaaattagaaaactaggccaccccgcaaatgtggtggcctagaataccgaaatttgactaagctatggcctgcggcctagaaaaataaaagtagactgtataaaattctcatcaagccttttggagatgaactggaaacccaaattttttggaagaaaatattgacctcctttaaaacggtggcctactttttctgatggcctaggattttagacaaagaagccacacagctactatccacatagtttcaggaaaaaaaataagaaaaataggctccgcccacatattcttttgaattagaatatacacgagccatttattttgctaagttttgaatgttagctccgcccacataatgatttgaatttcccgcccatttttctctcaaaaatttgaattccctgccaaatttttttttgcgaaaaactcaatactttcaggctcttcgcgcacagttcgacaaacacagcgtacacgtggaaacggcgtggctatttcagcggaaacgggaatggagacggggacggtagttcggatggatatttctcgcgtacacctgtctcatcactttttgacataaaagtggtcttgtgtgccagcatgttcttggtctcgttcattttggccctttttacacagtataagtgagttttttgacacgtggcctggaaaatgagaaaactcggccaccgattttttcagccgaatttttttagtttagcggtcacacgggcttctggccattctctctgcatttttcgcgctccattggcattggcttgccggacaacgcgtgggaaagtcgtgtactccacacggataaatttgttcagttttacattgaaaaccgagccgtgacacgccgtaaatctaccccggccgtggccgagtcaaaatggcatagttcggcaaattcttgaatttcaaaatatgatggaagcctgaagcacgtgcggtcataaaaatcaataaattatcttttttttccagagccgagtccacgatattccgatgtattttccgattttttgtgatcaataagaattggatgatcaaaaactacgatatcaagtgagtgggcggagtgtaatttcggcgggaaattcaaaatttttcaaatttttcagaaaaatttcgcgcaaagttcaaaaactcaaaactttcggtaaatttcggcgcgaaattcaaaatgttaaaaattttggggaaattttggagggaaaatcaattttaaaaaacgtttgtttgaaatttttttaattttcagaaatgatcccgaaatggctcaccgccgcggtctccagaagtcttcacctgttccgttaaccttatcagcttctg