Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C54C8.4   

sjj_C54C8.4RNAiJA:C54C8.4
PCR_productsjj_C54C8.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC54C8.4 Source_evidenceePCR729WS150 Sequence/Annotation Release
Overlaps_Gene C54C8.4 Source_evidenceePCR729WS150 Sequence/Annotation Release
Chunk_score Abs_score624
Max_abs_score624C54C8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1245032012451516
Overlaps_transcriptC54C8.4 Source_evidenceePCR729WS150 Sequence/Annotation Release
WB_DNA_textsjj_C54C8.41197tgtggagtgctacgcaaaagctcacggctatgaattcgttctcaccaatgattctaattttggatgcgatcatatcaaaatagtaagttagttaactattatacatactctatcaatcaatactcggaatttcagaacattttccgccggcactgtgttctggcgaaaatcttggttgactatgaagccgtcgttcatattgatggcgacatgggaattgtgaatcccaaacggaggattcaggagtatatgactgaaagttcagatattgtgttctacgatcgccattttgctccagaagttgctatgtgttatattgtgaagaacaccgaatatgctataacgttactgaacggtgagtgcgccagctgcagtaaattgagtagaccaggcttcggatgtgatttcagggtttcctagatctgatgattttgtttgttgtgtaagccttaagcatgtatttctcaaaattatagtcaaagttagtcaaaaagtataaaactaaggacatcatgatttgatcagaagtttggtcagacatagctatcttctaagaattggtaggtccatttttggcaggcgtaataagtgaccaaacacatttgtttacctactgcataaaataaacaactgatattcagagtttgccgagtacgaaagaaagctgccgaatagctcacacggatcagaaaatggtgcactacatgtgagtcaacgattttatcactgttggttttagaccagatcacctcctgaatttcagattttccttgccgaaaaattgttcccgcacaatcaaatcgacattgacgtttgccgaatcgcttgggagaactcttggaatatcgttgaccaatttgcatacacacattgcatcagagcaatttttggcgcttcaatcgattttgacaagattaggatcttaagaaaggttagttcagcttgtgctcagtgtccatgatcttgaattttcagggcactggatttgctcgtgacgactggatcaccggcggcgtttggagtcctgagcgagattttatgctgcacggatggaagatgcgtcaacttgcgccgacacccgccggagttgtcaaggctggagcgatgagtgaattgatttggtattctccgtttttgggaagctttgatatggagaagtgcagcatggggtaagttatagtccaaaatctgccgctt