Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C55B7.4   

sjj_C55B7.4RNAiJA:C55B7.4
PCR_productsjj_C55B7.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC55B7.4a Source_evidenceePCR775WS150 Sequence/Annotation Release
Overlaps_Gene C55B7.4 Source_evidenceePCR821WS150 Sequence/Annotation Release
Chunk_score Abs_score758
Max_abs_score758C55B7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64981146499028
Overlaps_transcript (5)
WB_DNA_textsjj_C55B7.4915ggaggctctggatcctcttttttcaatgcaatgattgtcattgaagagttggcaaaaactgatccatctgtatctgcaatggttggaattcacaacaccctccctgtatcaatgattatagattatggaacagaagaacaaaaactaaaatacttgcctcgtctctgttctgatagtcttgcatccttctgtatctcagaatcaggtgctggatccgatgcatttgcattgaaaactattgcaaaacgagatggagatcactttttgatctctggaactaaaatgtggattactaattcaggagaggcacaggtttttgtggtatttgcaaatgcagatcctagccaaaaatacaaaggtatcacatgttttattgtggaaagatcagcggatggtcttactgtagataaggaggtatgttcagtttttaactttagagcaaaaatgaaaaaaaaatttacaggaagacaaacttggaatccgagcttcatccacttgtcaagttcattttgacaatgttcgtgtccacaaatcagcaattctgggagagtatggaaaaggtatgagattctagtaaaatcaatcaataacttgcatgtttccaggctacaaatacgcaattgaatgcctaaatgcaggtagaattgccattggagcacaaatgattggactggctcagggttgtttcgatcaaacaattccatatcttcaacagagagaacagttcggtcagagacttattgattttcaggttatttttgaaattgggtttgaatttttgatacacaaatgttcagggtttacaacatcagattgcacaagctagaactgaaattgaggccgcacgtctactagtgtataatgctgcccgtatgaaagaatatggaataccatatgtacgagaagctgcaatgg