Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C55B7.8   

sjj_C55B7.8 RNAi JA:C55B7.8
Simmer:C55B7.8:Screen_A
Simmer:C55B7.8:Screen_B
PF:GL1_6E10
PCR_productsjj_C55B7.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC55B7.8 Source_evidenceePCR883WS150 Sequence/Annotation Release
Overlaps_Gene C55B7.8 Source_evidenceePCR883WS150 Sequence/Annotation Release
Chunk_score Abs_score799
Max_abs_score799C55B7.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64915836492683
Overlaps_transcriptC55B7.8 Source_evidenceePCR883WS150 Sequence/Annotation Release
WB_DNA_textsjj_C55B7.81101actttctcccaggaatcggtttatccagtgataagaatcgtgtaggctgtggacggcctgatcctgaacctttatgaggaacaagggccgcaaaagcaatatgaagatgtgcagcaagatagtatctgggccggcaatcctaaaatacatacatacagtaattttgcaaatatcaccaaaaaacatacataaatcagtttcattccagaaggattccccagtttgccactattgtgatctgcttcaaataaatcctttttccggaaaagccattccttatcaccaaaatcaggaatacctccaggccaatcgtgtgagagcattatgtcaattgggttctaaaataggaaaatgttcataaaaaagtaattttcaagcttataccgatatcttattttcattatcagatttcaattgtcttaaccggaacatatcaacgtttcgaacgtgatatgcgcttttaacatctctttccgaaaacgaagggcgttcgtaatgcgaaaattgaaaatctccttgcgagaaaattccagagagtcctgcgatacgaaggttagcaaatcgaatgcaatttgcgaatcccatgtaataaatattcggcgccacccatcctccattaggcaattcacatagataaccagatgcttcatggtttccgccgatgaatagagttagaactggtgctttttgttctccagaatagtatttatagaatgtttgaagacttctgtactttggtggaatactcatatgtggaaggtcgccgtagtttcggacagcttgataatcgccacaacagatcagcaaatcgaatttgtagccatttttctgttcgattagtgtcattgtctgaaatattttttttaaatagttgtaattttaaatagcaattaaaacaatctaatagagaaaatagatctgaaatatgccattaattttgttcgaaaaatatgatttttttttaaattttacctcataaatagcatccatttctccgtgagagcatccgacaacagcaattcgtattttcttttccccattgttaacttctttttcaactactaacgtctccggagcaggatcttgatgcgaaccttcatg