Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1007.8   

sjj_D1007.8RNAiJA:D1007.8
PCR_productsjj_D1007.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD1007.8 Source_evidenceePCR780WS150 Sequence/Annotation Release
Overlaps_Gene D1007.8 Source_evidenceePCR822WS150 Sequence/Annotation Release
Chunk_score Abs_score717
Max_abs_score717D1007.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI46043334605354
Overlaps_transcriptD1007.8 Source_evidenceePCR822WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1007.81022agtgtcgtttgtagacgtcgattttatcttcaaatttctgtgtttttctcacatattgttcatgatttcagatggaaactcaccggtatattccagaacatgccgtcccaatgccgatttcagcgctattcaattcaacaaaagaacgaatcgagtacggaacggcagacgttgttcgcgttcaagtgatgggtgtaatcgaatctgtgaagttcggagattctgatgtagaatacatgattactgataaagataatcataatattttggttcaaaaaatcctcaccgttagtctgaatatatcgtgtaacattggaaaaaagtattaatttcaggcttctttcaccgaagaatctgccaagaagttcaacgtcggggaccgtgttgaagtattcggaaaagttcgaattttggagaatggaaagaagtttttgaacgcattttcgatgcacaaagcttcagatgaacaattcgccgcttttcaaataatctgccgtttttcagagaagttctataaaaaggcaagtttcagtgaatttttaaaagccaataattgcccattttccagcacacacctatcttgccagcaggcgccagcaccaatgttcctactcgtttcggtttgaagaacaaagtgggaagtttgaatcggttcccaatgggaatgctggaacaatcatcttcttgcgaaaataatatgggagtgtggccaacggaaattgaacaattggcagcaggaatatcgacaagtggacttgttaaagaagaatcagatgtatctgaggatagcagtgatgattcggatgaagaggatgaggaggaagaagaagaagatgatgaggaagattcatttgataaaggaccagtgagccttgtgccaatggctcgaaaggagaagccaaaagaggagccggaaccagaatatgattccttcgaaaacgcctgaatttataatattcagcttaattttattttatcgtgttcaattttcacttatagacatcttgccttgtctttcattc