Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1014.3   

sjj_D1014.3 RNAi JA:D1014.3
Simmer:D1014.3
PCR_productsjj_D1014.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene D1014.3 Source_evidenceePCR655WS150 Sequence/Annotation Release
Chunk_score Abs_score592
Max_abs_score592D1014.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV81338718135039
Overlaps_transcript D1014.3.1 Source_evidenceePCR655WS150 Sequence/Annotation Release
D1014.3.2 Source_evidenceePCR655WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1014.31169aagtttctcgtgagcctggaattaatcattttcgttgtcttcatccaacatgcgaaattcgattttctaataaccgaacacgtgatgagcattcacggattattcacttcatccatggtgaatcgtctcgtcggcggaaggcagaagacaatggagtcacatcaatcttaaatggtgcaatgaacaaaatgagcttgctggaaggtgaagataccggatggtctggtgaaatgcaacatggattagaaatgaaaacgaaacgaagagtaaaaaaagcagctcgaaaaatgaatctcgcccccgaaacgcacggaatatgaataaaatattttaaagccattaaaattaaacaggtcgcaataaaactactaaatatttcagttttttttttaatatttatgatgttttgtaatattttagggaggaaatttgttcaaaatggcaaaaaattggcaagccgctggtgacgcattcctggaagccgctgaattctacgctaaaaatggggactccaagcacgactgcgccactcagtatgctgaagctgcgaattgtttccgcaagattcaaccagaggttcgagatttcgagacttgttcgtaatttaagaatcttgatttttcagcgtgctgttcaatgtcttgaaaaaacttcggaaatctacactgacatgggtcgcttcacaatggccgcaaaaaatcatgtaagcattgctgaactctacgaaactgagcttccggacaaagagcaatgtgtgaagcactaccaacaagccgccgactattataaaggagaagaacagaaaagtagtgccagcaagtgccttgtcaaagtagccatgtattctgccgaattggaaaagtattctcaagctattgctgtattcgaagagattgcattcttcgaagccgatcattcaaccctcaagtatgctgctaaaggacacttcttccaagctcttttatgtcatttgtgcattgatccagtaagctcccatctgcattaacactgaaatcgttttatttttaagatcaacacacaacaagcacttcaaaagtacgaaaacgcgtctccatcgttcacagattcgagggaatgtaaatttgtaaaggaactattggcagctattgatgaaaagaaagaagaaacttttaccgaatgtgtggcaa