Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D1081.3   

sjj_D1081.3RNAiJA:D1081.3
PCR_productsjj_D1081.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD1081.3 Source_evidenceePCR812WS150 Sequence/Annotation Release
Overlaps_Gene D1081.3 Source_evidenceePCR812WS150 Sequence/Annotation Release
Chunk_score Abs_score686
Max_abs_score686D1081.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84702578471954
Overlaps_transcriptD1081.3 Source_evidenceePCR812WS150 Sequence/Annotation Release
WB_DNA_textsjj_D1081.31698ctaacggagctcctcgaatgaatatgcatgattcaccatttgtgaaaaaaaaaatgcttcattggtcatttctcatttcctcacctacaaaaataggtaacaaacattaagatataatagttattaattcttaccgaatcgacaaaggtgtgatctctctcgtttccaaacactcctgttcgatccaggcgtattttatttttgtctggaaatcaattcaaatattgaatttcatttttcgttaccttttggaagacatacaactggtacagacataacacttcgattcacaactaatagcgtcaaaaatccaacttggctagttacgaactcacagtatcggaggaaatgtatctgaaaaaacagaaaaattataaataatacacaattccaaaaacactctacttcttcgacctttttccattgttgtctgctgtccaaaacacggaaattcataccattagtatgatagtttgcacttctgtctgtttcacaaattgagctattgacaggcgtttcgtcagacttccatgtccactttcctgactctttctcctgcgatgaatctgactttgatctttctgtatgcttcgactttctgaaatcgatgcagattttttcaagctgacacttcgaaatccgaaaaatctgacgcatttgccacttattaaaatgttttattatttctacgccccaacactttcgcttcaaaattaaaaaaaaacaaacaggtttaaaaaaccgcagtaatttttcaaaatctaactattccctaaaaatcataattttaaaaaaaatatcacgatcctcacagtattttgctgtccagtttccaataaagttacgcttatgatataactaaaagctctcattttctgatttaaaaatccgcttttattaatataaatttttttaacgtataattaggtaattaggtataattaggcaagaaggtttagggttttttaaacgtagacgtaggttgccttgcaggcagttttgagaattctgcctactcacttccattttatgaaccaagatgatgatgtgagaacatgtgtttgagaaatgaacactgcatttgttggtggaatttctagaaaaaatattcgtgttgatactctttgtgtgtgcctttaaaaacgcgattaatgactaaccagtagttatttcacgtttcttcgtaggtgtttcagttacagctgttcctgtagaaactgtcgaattatcagatgttttactagaatctgatgaagtgttaactgaaacttgtgtgctggtttgtgtagtgagtggactcttatcaatcggagtagtagtgtgtacttgagaatatctggattttggtggtttcttcatttcagacagtttggtttcgtatgtatcgtgagtatataatgatgcaagccaaagtggttcagctggaattagatgatttcattcatctttaattcatcattaaaaactcacccatcggttcaccacaactaccatatcgaatttcattttctcgatgactcagacgaaatttcgaatcatagcaaatagtttcgagaagcaaagtgattaagattattaaaaatttcatactttttgagaaatgactaaattgaattggaatatgagtctcaagaaatgttcacgtttttgcaacagtacatgacatttcactagatatttcataatgtcgaggcgtga