Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2005.3   

sjj_D2005.3RNAiJA:D2005.3
PCR_productsjj_D2005.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2005.3 Source_evidenceePCR375WS150 Sequence/Annotation Release
Overlaps_Gene D2005.3 Source_evidenceePCR438WS150 Sequence/Annotation Release
Chunk_score Abs_score337
Max_abs_score337D2005.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78137617814686
Overlaps_transcriptD2005.3 Source_evidenceePCR438WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2005.3926aatttattgaagccatgaaagcagatacgagttaatttgaaaaaagaaagcaaactgggcaatttagaggtcgagctcttcatccgaatcgagctcattgcgccgacgatcgaacttgactgacgtggctttctgagtttgagcagatactcgttccatcaatgcttttaatccatcatcggtcatttttccagatagttgtcctcttctgaaacaaaatatatttattttcagttttcaagtgacaatacaatttttaatggagaatttattctcgatttattaattagaattttcgcttctgcggcaagagttcaatttctaatatttatggctcacgaaaaccaaatttatttttaagttttaattttatatgaaactattaatttttaacaactaaatttgcaatctttgagattattttagcaattttagtttcagaatagttcataaagcaagaaaaacgttaccttgccatattgatcaaggcagcttccaccatttgagctttttctggctttgcaacagcaagattgctcaatctttgcatcgccgcttgatcgagaatctgaaaaatggctcgaaataattcataattttacaaaatcctttgacaaacctgagaaatcatgccattctttgcagtttcctgattttcagcttgttggcgtgctttttcgtgtgcatcctataatttgatgaacattaaatgtttgaaaacctaacattatgcatctcaagaaaacaaaaatttaaaagatggtgaattatttacctgagatggctggggaatagaagaggctccctgagcttccatatttggtgagaattgagaaaactgaaaatgtttgtgtgtaattttaaaaaacaaattaaataaaacaattttaaacgcgccggaacaggataaattccagagaattcgc