Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2005.5   

sjj_D2005.5RNAiJA:D2005.5
PCR_productsjj_D2005.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2005.5 Source_evidenceePCR718WS150 Sequence/Annotation Release
Overlaps_Gene D2005.5 Source_evidenceePCR718WS150 Sequence/Annotation Release
Chunk_score Abs_score676
Max_abs_score676D2005.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78245457825701
Overlaps_transcriptD2005.5 Source_evidenceePCR718WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2005.51157cgctcaacgtgtcagtgatttcttgaacgaatctaaagttttagatcaatttggtaattatggtgaacaaatggttggatatgttctcggaacaaacaaacagggcgctgtacagcagacttcacaagaacaacaattgacacttgataaattcaacaatggaagacttaaagtaattgtggcaacgtcagttgttgaagaaggtctcgatgttactgcatgtaatcttattatcaagtacaactgttcatcaggatcagccattcaacttgttcaacaaagaggtcgtgcacgtgccaaaaactctcgttctgtgcttttatcagtgaagagtagtatcaatgaaaccgagactaacgcgttaatctctgaaaagtatatgagactttgtgtgaagaagatcacagagaatggcgagaaacaattggctgcagaagtgaaacgagtcgctgaactaaatgcggctgaaaggaaacgaaatctggaagagcaactcaatttgagattacgacatgagaataagatttataaattgatgtgcagcaattgttcaaaagagttctgcaagagtatttatatcaaaaaagtgttctcgaattacatggtgttcgatccaagtgtatggagatttttgcatgttgaatcggtacgtttgatgaatgctcaaaaaccggagccggcttgtcgaaaatataattttaatgaattttgtaagattatactcgtagaccagggctgtaaaaccattttcccaaaaaaccgaaacctaaaatttctcaaaaaaaaagacaattaaaaaaatttctgtcactaaaaaatcgttttaaagtaaaaaaatcgctttattcatctgaaattaacttattcaggttgaaacatttataaagtgcttaaaaattacctggaagtgtcgaattgccgattatcaaattgctgaatttccgaactttgctttccgacaattgactttcaggctatttttgtgcaatttccagatgtttcaagtaaatgtttttttcagctaagccgacttctgtttatcatagaaacgcaatttgtgattgtgaaaaattgaattttttcagaagcgaaaggtgagtaagtacttgagtgaggacaatcaaccactcagtgatatcaaatgcttccattgcaag