Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2030.9   

sjj_D2030.9 RNAi (13)
PCR_productsjj_D2030.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2030.9b Source_evidenceePCR705WS150 Sequence/Annotation Release
Overlaps_Gene D2030.9 Source_evidenceePCR705WS150 Sequence/Annotation Release
Chunk_score Abs_score625
Max_abs_score625D2030.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75988197599798
Overlaps_transcript D2030.9b Source_evidenceePCR705WS150 Sequence/Annotation Release
D2030.9a.1 Source_evidenceePCR705WS150 Sequence/Annotation Release
D2030.9a.2 Source_evidenceePCR705WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2030.9980tgcacccaacttcgtaatgaaattaattctcgttgtggtccacgtccatcaacatcgaataatatggaattcatcctcaatcgagaccttcaaaaacgtggaacatcgatctcaaacccgcgaactgttgctcgtgttctcaattcacatttaccaaatcagaagcgacgtgtcgatcgagtagcgacaaaatcattctgcacgcaatatattcaaaatggaacgaaaatcgtggtggcaagtcagggtgagatatttttgatacgaattcccaaaaaaacaatttaatatttcagacgaaaagattcgattctaccaaagaaatccagacaagtcgaaatacagatcaaaatatatgaaatctgatgaacttcgtgttgatcaatgtggttggtcgattcttgatacagcgattagtctaaatggagatttaattgcttatggaacatggaaagatgcagtttttgttggaaaactcgactttacggaaagacaaaatatcacatggtttccaattgatttgaatggagaaccaggaagagagtgagtacatttcacagcaaaaaataattgtattagtacaataaatttgatttttcagtcactgtgcagtcttttgtgtgaaattttcggatagcagtgaacaaatcgtgtgtggtacatcacagtattcaattcacgtatttgacgtcgaacaacggcggcggattcgtacaattgtgaatgctcacgaggatgatgtcaattcggtgtgctttgcggatcttggatcaaatttgatatatagtgcaggagatgatggacttgtaaaggtatatttctttgaattgtttcgagaaatcttcagaaaatcctaatctgtgatttttttaatcaaaagtcattctgaaattaccaagactagaaagtttgctccaaaaatactgtactcggtctcgacacgatacttttaaatgaaattcagaagctgtgcgctttta