Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2092.3   

sjj_D2092.3RNAiJA:D2092.3
PCR_productsjj_D2092.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2092.3 Source_evidenceePCR727WS150 Sequence/Annotation Release
Overlaps_Gene D2092.3 Source_evidenceePCR727WS150 Sequence/Annotation Release
Chunk_score Abs_score643
Max_abs_score643D2092.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI66232656624955
Overlaps_transcriptD2092.3 Source_evidenceePCR727WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2092.31691ccaatgttttggcaagatgtattttttgttgaaaagtttgatatttttgataaattcatatacttgcatattaaaagcctaggttgtttgagttttattgaaacataattaaaatcactcactcagagagaaattttggtcaattaaaaatcttgtgataggcgaaactgagtaattgccaattgacagtagataaaaaatatcatgaactatttgaaaagttttcctttttttttaaatacaaaaatttatcaaatagaacttcaaacataccgtagtacagggttcttcttcgaatatgcaaataataattaacagtcggatatggttctgggcagcatttgtaataactgacgacacgttttgcgtttgtactgataacctgccattctccatttaccaggtatgttgaaagatccattgattgagctggaaatgaggatataaatagaacattgtatgtcatttaaaacacgtcaaaaattttacttccattagtgtcatcatcaatttgtagatcaatagcgtaaccatggaatgtccatgaaccgaatttcatttcacaaacttgatcatcgaatggaaaccacgttacgtcgagttgacatacaaactttaatacaccaggaggaatccatacaacagttcctgtgtgatatgtgagcaagtttgatttgaatgttgagtcaaaatcttcagcagcactgaaatggatcactttttggctatatttgttggtaatactacggtaactcctctattagtcttgcatacaactaggccactttggcaacgattacctcggctcacagttttatgataatagtaaatgtttacttttaatctatcaaagcttttgaaaaaatctttgtccgtaataaagatgttttaaaacttaaaaaacagctacggtactattttcaattttttttcaaaatacgctattttcgaatctctttctcatcaattcaatatcatgtgtatcgtttgacatcatagattctaaacctatataaaatatacctattgtataataaaacatcaggtttccaaatatgatctgagcttcctggaaatcgaatatcctgaattccaccgtatttcttcggttcccattgcaatttatgatcaaaccatgtctgaaagttatttgtttttcttgctaataactatgaacttaaagggaggtgcatttatgcggatgggttccgcaatgtggtcgacatttattgttgtctacaaaaattgtaaaggcattcaaaacgattccagtttgaagttcgtataaaataattttgtactcaaatgctatttatgctctgagagccttcaaccaagacttacataactgagccacgcattcactgaaacaatttgatttttctcatccacatccaaaatttgttgtaaaaaaagcttaattttaacctctaatggctgagatgagttttgaacgggcctctccaatggattgtatccttaaatttaatacatttacaaatgtttttagttattcaattagaacctttcagtaaatctgtaaaaagctttgtctccgcaacacttccgtcgcacaggtttgaatgaataataactagagataaaatactattaattagattaaatatcatttcaaaaaaatgtggctaagattttctaaaagccgatgcatttttgctggttgattactc