Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2092.8   

sjj_D2092.8RNAiJA:D2092.8
PCR_productsjj_D2092.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2092.8 Source_evidenceePCR324WS150 Sequence/Annotation Release
Overlaps_Gene D2092.8 Source_evidenceePCR461WS150 Sequence/Annotation Release
Chunk_score Abs_score398
Max_abs_score398D2092.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI66204136621376
Overlaps_transcriptD2092.8 Source_evidenceePCR461WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2092.8964agattcacaccgtcaactctcatatcactgcatcgtttaacaaaaaaaggcttctccccccgttctctccttcttcctaaatctgtttctgccaccccgacaattgtttagccatcgttttcgtcgtgcaagaggagccatctcataatcgtctcctcctcctcttctaccgaaacgggttttgtacctaagaggaaaagtgggcggagatgtgttgatccggtataaaaaggacgacggttggcatgccaatgagccattttactttctatctttcctttcatctcccttgcagcttttacagcttccccacttttctatacacagaaaatggttagtttctgaaaatctcaagtttttttatttatattcattcaatcctagattgcccgtctcgccatcgccgctcttcttgtctcaagctctcttgcctgtcttccaggacttggaggacttggtggaggatgtggtggagccgctgcttctccatgtgctgctcctccaatgccaccaccagtttcctgtggaggaggatgtggagctgcgtaagttccctgttaagtgtactagattgagtgaaattgatattttacagtccatacccagctggtccaatggctgctccatacttcgccccagcagccatcgctccaccaccaccaccacaaggagccgtgatcggagttggagctcagccagccgtttattccgctccacttccagctggaaatgcttacgttggacaaggaaaataaatggaaaaacagtgaataactggtccatagccatctattgatcttcttatcttcataatttctgtatatttgttggttatttttattttattatttgacaatttttaaataaatggtgacagttgaaatgagcaggaattactaaagaaaatgatatttgtaaaaaattggagcaattgacactttctgaaaatcctgacaacgaaaag