Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_D2096.8   

sjj_D2096.8 RNAi JA:D2096.8
Simmer:D2096.8
PCR_productsjj_D2096.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2096.8 Source_evidenceePCR874WS150 Sequence/Annotation Release
Overlaps_Gene D2096.8 Source_evidenceePCR874WS150 Sequence/Annotation Release
Chunk_score Abs_score790
Max_abs_score790D2096.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV83780908379239
Overlaps_transcriptD2096.8 Source_evidenceePCR874WS150 Sequence/Annotation Release
WB_DNA_textsjj_D2096.81150ctgacacatcatcaccgtcctctcctgggaaatcgaacatatcgtctgattgaagttctccagtgtagaaaagaacagcacgtggaatgatggtatcacggatagcttgtcccatctcgtagtcgagctcaaggaactcctctgcctgttcatcgtcctcatcttcatttctctcgtccttgctctttggtggctcgaagaagttgaagaaactatctgctttcacagttttggtgaggaactttccagcattagctcccttcttttgcttcttcttgacagccttcttggtgacgttcttgccgtcttcccactcaatagtatctccgacagcgcggatgacatgtggtccatcgaattggagtggtgcctccgcatctgggtcgaaaccgagcaagtaggtcttggtaagaacttggtttttgaagtatgggttggtggcaaagtggaactcgattttgaaaccctgaagttcaaaacattaactttcgaaaacaatgaaatgcgcttacggctggatccttgctagcggcggtcgtcacatcagtgagatatgagaggattggtacgtcatgctcctcgatggcttcagcaacaagatcatgggttctgagagcggtgagccagaaatccttgatcccctttgctgatgggtcagcctccgcagctttgtacaattcctgaaacaaagaaatgtcaactaataagctggaattgtcatagccatatcatcgcgcaagaaacacaatccaggagcgggaataaaggacatgttttatttcgcaacgaaaaaaggcgtgccccacgggaggcaaatctcttgaatagttgcaggctatatagggaatcttgattaggaacttacagcgagttgatctccctcgagtccttcgaggattggagtgtcgatttgttctttagttggctcgacctctcccgcgacaatagcctttctttgatcgaaagtggatttgaactttccttcaaactcgatctcgagctcgtgaacacgtttgtagaagtcagattcaatctgaaataaattatatacttaagaacataaacaaagaaaactaacctgaattgtcttcatttgaaggtttttgagagcgcagacgcgttgcttgacattgagaggcaaagcctgaat