Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_DY3.2   

sjj_DY3.2 RNAi JA:DY3.2
Simmer:DY3.2:Screen_A
Simmer:DY3.2:Screen_B
PCR_productsjj_DY3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene DY3.2 Source_evidenceePCR1078WS150 Sequence/Annotation Release
Chunk_score Abs_score1036
Max_abs_score1036DY3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87635808764766
Overlaps_transcript DY3.2.1 Source_evidenceePCR1078WS150 Sequence/Annotation Release
DY3.2.2 Source_evidenceePCR1078WS150 Sequence/Annotation Release
WB_DNA_textsjj_DY3.21187aagctctcgttttggacgaatgataagtgttggaatatagattatttgtattttcaggctcgtctccgtcgtgccctcgattcggctcaagatgagctcgcaaaatacaggatcgagtatgacgctgcaaaggttgaagtaaagaagttgaagccacaagtcgaaaaacttgagagagaactcgctggagctgaggaacaagccctccatgcccaatctattgctgatcaaagtcaagcaaaacagaagacgttgcaggcacgcaacgataaattggtggtggagaatgatgtaagaaattttaattttatcaaaagtaaatgttcaattttgttgttttcaggatctcaaaaagcagaacatcactcttcgtgacaccgtagaaggactcaagaaagccgttgaagatgaaactcttctccgaacagccgccaacaataaaatcaaggctctggaagaagatctcgcttttgctcttcaacagcacaagggagaacttgaagaagttcgtcacaagagacaggtcgacatgacaacctacgccaagcagattaatgatgagtatcaatctaagcttcaagatcaaatcgaagagatgcgtgctcagttcaagaacaatttgcatcaaaacaaaacagctttcgaagatgcctacaaaaacaagctcaatgctgctcgtgaacgccaagaggaggctgtatccgaagcaatccatcttcgtgcccgtgttcgtgacttggagacatcaagcagtggaaatgcttcgctcatcgaacgtcttcgttcagagctcgacactctgaagagatcgttccaagagaagctcgacgacaaggatgctcgaattgctgaacttaatcaagagatcgagcgcatgatgagcgagttccacgatcttcttgatgttaaaatccaattggacgccgaactcaagacctaccaagctctccttgagggtgaggaggagcgtctcaatcttactcaggaggcgccacaaaacacttcagttcatcacgtctcgttttcatccggaggagcaagcgctcagcgcggagtgaagcgtcgtcgcgttgtcgatgtaaatggagaggaccaagacattgattatctcaaccgtcgctccaaactcaacaaagagactgttggcccagttggaatcgacgaggttgatgaggaaggaaagtggg