Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E01A2.g   

sjj_E01A2.gRNAiJA:E01A2.g
PCR_productsjj_E01A2.g
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS E01A2.3a Source_evidenceePCR695WS150 Sequence/Annotation Release
E01A2.3b Source_evidenceePCR438WS150 Sequence/Annotation Release
Overlaps_Gene E01A2.3 Source_evidenceePCR904WS150 Sequence/Annotation Release
Chunk_score Abs_score820
Max_abs_score820E01A2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI41271414129452
Overlaps_transcript E01A2.3a Source_evidenceePCR904WS150 Sequence/Annotation Release
E01A2.3b Source_evidenceePCR637WS150 Sequence/Annotation Release
WB_DNA_textsjj_E01A2.g2312caatgcaatatttccattcaggtttccgagagtcttctctgatttgggcgttgtcatctgcatctgccgcctggggagttgcgacggcatgcgcacaaggatggattgacgattgtgcgtgtaacaaccagatgggtcaaaatgaatacgagttcggcgggtagggtcaaaaggaattagatgagatgaaaaagccggttttcttgtagatgtactcatggtgttcaacacggaataacggctagtcgaaagctgctcacaaaggtcggagcggtgaatactttgttaaggaaggtggagaagcacaatttgaaggcagggagattggtgagtaatctaaaactggatttttgatatttttaaaaagatagaaaatggtatataaaaagtggatctaaatattgggtgctaaaattatgaacaatttttcggggaaccgaaacctataagtacccaatttttgaagccaaaaacccagcatcgggtcttggcacgaacgagactttacgactacagttactatatgtcttccattttcgaacgctttttcctcttgatatttgaagtttttagaagacaatgcacgacagatcttaaatatacgtacgtttaaaagtgaggaaaaaatggaacaaatattaagcccgggtacggtagctgaaaagtttcgctcgtgtcaggaccggaggccttagttgtagtatattatacaattattcgggtcttatcacaagacacttcaaaacaaattttaacttttatcgcggcgagacccagcataatggatggtaaataccagtgatttaataaagttttaaagtgacttcaatgaaacaaaaaaaaaactaaggcaatttttacaggccatcaaaaagaccctaatctcttcctgcaaatgccacggagtatccggttcttgtcaacagaaaacttgctggaaacgaactgcaacccttgagcacattaccgattatttagtggaaaagtatgcacgagccaagctctatacggatgattcggtggtaaagacgacggatttgatatatttagaagcgtctccggatgtttgcaaggtacgtatacacgtgtataattcttaattgataatataaataattctcaattttatttttaattctttttgcattttcaaattcaaattgccaattcatctcatctctattgtttttttattaaaaaaaccaaaaaatcccgacacgacaaacttttaaatgaacaaatgcatgcgcctttaaagagtactgtaatttcacctttttcaattttcttcgatttttcatagttttttcctataaaaatcaatgtatttattcaaaaaactaaatataacaatagaaacacttaaattccaacaaaaatgagcaaactataaataatttatgaaaactccgcattctttaaactacagtactcattaaaggtgcacaccttttcgaaattaattgattaacaaaaaatgtgtcgtgccgagacccgataccgtatttatcgtgcaaaaatggcaaaatttttcgcttaaataaatagattttataatttaaaaaatttacaattataataattatatcagtcaaaaaatgcactcttctcctcgggtagtacacgagccccgtaaatcgacacaatgatttttccaagttcaaatccaaaatttaaatttcaggcaaaatcagttgccggcagagtgtgtgcatggaggaatgagacgcatacccaaggtgattgtgatcggctgtgttgcgggaatggattcagcgtgagtttatttaaatattcttgggtctcgccacgaaaactaatttccagattcgtcacgaagtggtccgtgtgaagtgtgactgtgaattcgtgtggtgttgcaatctggtctgtaaggattgtatccaacatcgctggatatccacgtgtaatgggacaccgccgaaaagcctaattttttaatatttaatttctttttttttgtttgattttttttcataatttccagtcgaaatcagttcgtttttttccatttttcctcctgcacgggtcaaccgaaactctctcgatttgtacaattcatcttgttttctaattactttttttgccgtccttgcatcccacaccgttttcatttcctcgcctttcttcaataaatatgctaatttatcgccattttcaatcactttcccgctagaaagtacagtacagcacatcggaaatgacaccaattcttttttttttgcgtgcgcgcgcccaacggatctatgtacataaaagagtggggatcggatgaatgtgtgtcaaaaata