Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E01A2.h   

sjj_E01A2.h RNAi JA:E01A2.h
Simmer:E01A2.h:Repeat_b
Simmer:E01A2.h:Screen_A
Simmer:E01A2.h:Screen_B
PCR_productsjj_E01A2.h
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE01A2.2a Source_evidenceePCR1958WS150 Sequence/Annotation Release
Overlaps_Gene E01A2.2 Source_evidenceePCR2028WS150 Sequence/Annotation Release
Chunk_score Abs_score1923
Max_abs_score1923E01A2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI41327834135133
Overlaps_transcript E01A2.2b.1 Source_evidenceePCR1958WS150 Sequence/Annotation Release
E01A2.2b.2 Source_evidenceePCR1747WS150 Sequence/Annotation Release
E01A2.2a Source_evidenceePCR2028WS150 Sequence/Annotation Release
WB_DNA_textsjj_E01A2.h2351atcccgtaagtcgttctggtaatggttcggatttacccactgaatcggattccatatattcgggaccacttcaaacattcaaaaagttcctcactagccaggaagatgatatctcggaagaagatgctatcaaaaaatataatgagtacaagacagaacatagaaaacatcaacttgaacggttcttccgtgcccataaagacgaagaatggtaaatttcagcttcgattttcaagaccagaggcgcattatgccgcggtcaacggattggttatatctttgaatttttcactcggcacggatgccattcacattttgttccaatacccgttgtcttttaatatcttgagttctaatttttcaacatctatttcaggttccgtcttaaatacaaaccggatgatgcgaagaagttgcgagaggcgcatttggaaaatgtgcagaagcgcttgcaggttttcaatgagttgaaggagcagggacaattcaataaattctctctggatttcggagatgcggaggcaatcattagaatgctagattcaggtagattttgtttttaaaggtttcgaatatatgtttaattttgttgtattttcagttgttgtcaagctggaaaatggaactgaagacgagttgaaagctgttctggctcaaaaactagaagacgagtcactcgctgacattaaaaaagacgagaatgggaatggaaccgaacagccgaaagaagagccagaagtaaaacaagaatccggagcaacggaagagttggaagagggagccattgaagatggaaccgaaaagtcatcgaacaaggtcaacatccacagaacctgctcggttttcttgagaaatatcccaccaggtctcacatatgaggaactagagggtctctgtaaaaagagcccaggatttttacgtcttgctctgaccgatggaattgccgaaagaaagttctacagaagaggatgggctacattcaagcgagatatcaatatcaaagaaatctgctgggcactcaacgcacatcgtctgcgagaaactgatctgaatgcaatcatcaaccgtgacattactcgtcgtgttcgtaccaataatgggattgcatctcataagcaagttgcgattaacgatctgaagcttgctgtcaagctcactgttctttatgacaagaagattggtttgttcaacgctgctgatgaagctgatgctgatcgtgagatggatattcgtatgggcgttgatttagtcgctgcttcaacgaatccgttgattaaagaagttaaatcacttgttccacatgatgttctcaatgatattagtgaagaggaagctgaattattgggagtctcgaatggaggtgaagcaccagctgaaaagattcggtttgagcgcgatgataatatcctgaaggctctcgatcttctcatcgtttaccttcgcattgttcattccatcgatttttataatcacggacattatgcgcaggaagattcgatgccgaatcgatgtggcttgattcacgttcgtgggcagccgccttctggagtatcaatcactactgacgaggatggagctctcgtcgttccacagaaatttgtgaacgattttatttcgggattcaatagccgcattgagaaagggttgattgaaaagcagtatgtaagcgaggaagaattggagaaaatgggcaagaaggatggagaaaagtaagtgaaaaaatttgcttttttaaaaataatttttaacaaacccaaattttcagggaagttgaagcttttattcaaaagaatactgtcgagttggcaaaggataaatggctctgtccgctttctggaaagaaattcaagggacctgaattcatccgaaagcacttgcagtctaaacatgaagacaagctggaggaagcgagagcagaagctgactttttcaacaattatcttgccgacgcccaaagaccagtcgactgtgagcccaaacaagctccaagagatgatcatcgtggaggtggtggtggtgagcgaggtggatatggaagagaacgagacgatgatcgaggacctggtggtggaggaagtgagttgttcaactcttgaaatttcataaatatgattaattttcaggaaactcttttggcggtggaggatatgatcgtcgtccccaattccctcctcgacattcacttggtggacgaggtggtggtggacgctacttcgaggatgcgccacgtcgtcagccagtctcgtatcgcgatttggatgctccagatgatattccataattccatcctacgttgaatccaattcaaatatatgcacaacaaattatgctatttatttcccccttctcaa