Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E02D9.2   

sjj_E02D9.2RNAiJA:E02D9.2
PCR_productsjj_E02D9.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02F2.5 Source_evidenceePCR350WS150 Sequence/Annotation Release
Overlaps_Gene K02F2.5 Source_evidenceePCR443WS150 Sequence/Annotation Release
Chunk_score Abs_score360
Max_abs_score360K02F2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI68049736805772
Overlaps_transcriptK02F2.5 Source_evidenceePCR443WS150 Sequence/Annotation Release
WB_DNA_textsjj_E02D9.2800gcgagaaatgaatggtgttttagtcaaccgggaagatgagagccagcgaggaatatttttagaattaaaattatgatttagagctaattattcttaaaagaatctcaatcgtctagtggctctttcattaagaattgttgcaatttctgctatcctttgacgtagttcaatttcatcttgttcttctgcagcggcttcgataagtgcttcttctggcacaaagattacctgaaagttttaaatatagattcagatattacggaaacaaaaatttttcgaatttcgaaagtcgacacggtcgctagtcgtttaatgaattactgcagttttcgctacgagatattttgcgcaatacgcagtctcagaattttgtgttccagtatatcagttttgtagcccaatttttccaaaacctagttaaattattctaattacctcttgattttcttcaaattgttccggtagatcattttcatcataagcctcaaatactggaacggaacgacgatcacgtggcatgtattcaattggttgggttactgtaacaaggagcggatatcaaatataaaaatcaaatgaacttacaatattctggtaattcaataacttcgtaagcttcaactgattctggattgtattgatcaatttcattttgtacgatttccgcgagaactgccagttgatcatcacttagatctgcaagaaaaattggaacttttcagaaattgtttttcatttttcaacttaatctgcaaaagaaaacattagaatatttttccttgttcttgttgtttttccag