Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E03A3.3   

sjj_E03A3.3RNAiSimmer:E03A3.3
PCR_productsjj_E03A3.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE03A3.3 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene E03A3.3 Source_evidenceePCR384WS150 Sequence/Annotation Release
Chunk_score Abs_score321
Max_abs_score321E03A3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII40582244059117
Overlaps_transcriptE03A3.3 Source_evidenceePCR384WS150 Sequence/Annotation Release
WB_DNA_textsjj_E03A3.3894cgcaatctttaagacagaaaagcaaacaaatttatcaataaaaataggattttaacttgtggccttaaagagggccgttgggttcggttagttgggctagttgaatttagttgcgttcgcctcgaattcttctagcaagttgcatgtcctttggcataatggtgactcgcttagcgtggatggcacacaagttggtgtcctcgaagagtccgacaaggaagtactcggaggcctcttgaagagcttgaattgcagccgattggaagcgaagatcctgtttgacgtcttgagcgatttcacgaacaagacgttggaatggcagcttgcggagaagaagatcagtggacttttgatagcgtctgatctcgcgaagagcgacagttccaggacggaaacgatgcggcttcttcacggctccgacgacgattgcgttctttcgagcagctttcgttgccaattgctttcttggtgcttttcctccgggacacatcctactgaaaatttgttttttatgtatttgaaatttgaaatttgtttaaaggtgccgttagggttactgtaatgcaaaaatttatatttttgcaatattttcttttgttgttcgaactttaatgtcagtttctttgtttaaaaagttagttttttatttgaaaaaaaaaattaaaaaaagaaagtttcgtaaggaaattgtttaattgatttttttttcaaattaaaaaaaattttattttaaaaaataaacattttttaaatgacgaaaaactgacattaaagaggcgaaaacgagataaaattaaaaaaagaattttcgcattacagtaatcctaacgataccttaagaaaactaatttccaatttcataattctgaattggaggtgtctccgtaaacttta