Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E03H4.13   

sjj_E03H4.13RNAiJA:E03H4.13
PCR_productsjj_E03H4.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE03H4.13 Source_evidenceePCR710WS150 Sequence/Annotation Release
Overlaps_Gene E03H4.13 Source_evidenceePCR710WS150 Sequence/Annotation Release
Chunk_score Abs_score619
Max_abs_score619E03H4.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1244000912440938
Overlaps_transcriptE03H4.13 Source_evidenceePCR710WS150 Sequence/Annotation Release
WB_DNA_textsjj_E03H4.13930gcaatgtgatgagatcgtggaacagatcctgaaaacaaaagttttttggcatatttataaatttcagcttacagaaatcgtcgtgatttgcatggtgatttcacctattcttacagcaatatccatatcagacatgtagttctgtaaacaagattgaaactttttttttagcttactacatattagtagttgctcttacctcgtagtactgccttaatgcaccagtaattcctttgtaatgttccaaagccagtgacttcatctttggactcgtctcataaaatttcagattccaaatacaaattgctcggagagcagcgtattcaaagatgtttaaatttaggtttttgagagacaatccaattgatgtatcgatttgataggcgaacttgcaaatgtcatttccatccaacaattcctcatttgatgtcgattttgaataaacgaatgcagagtcaatccaagtgttcataaatttgaagtatcttatcaaagtcgtaatgtcttcatcgtctaagatatatgttccatagcaatgcaggacagcatccaatgaggttttatcttcagatttcgagatttcaagcagttcctttgaagttttaacttgatgggcgttctggaaaacaagaaaataaagtttaaactattatccttatcctacagtaaataattaatatctgtaacttactttcaaagggctttgccttttccgagcaatgctttcattggcttctttcacataaaaattgagcagttcctcgtaactttcgctcaatttgttgctacaggagacggcaggtgatttagcttcttttctgcctgcctgacgcctataactttgtttccgaacacctgtaaatcaatacttcattattaccccagtttactcaatgcttacaatctctcctcatccctgactgcacacat