Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_E03H4.2   

sjj_E03H4.2 RNAi JA:E03H4.2
Simmer:E03H4.2:Repeat_b
Simmer:E03H4.2:Screen_A
Simmer:E03H4.2:Screen_B
PCR_productsjj_E03H4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE03H4.2 Source_evidenceePCR527WS150 Sequence/Annotation Release
Overlaps_Gene E03H4.2 Source_evidenceePCR527WS150 Sequence/Annotation Release
Chunk_score Abs_score485
Max_abs_score485E03H4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1240369112404829
Overlaps_transcriptE03H4.2 Source_evidenceePCR527WS150 Sequence/Annotation Release
WB_DNA_textsjj_E03H4.21139aaaattttgttcacgtcggcagttggatcggctccgtagaattccatgttagggtgaagttctttcaagcctatctctcccgtaacgtcatgtccgatgcccaacgtgaccattgtgagaagttgagtttggtttcgaggaagtgcaacatacttaatctcgtctatgttcaagacctcgcggatgtcgaacgccttgtaggcttggagattgtcgcattcttttgttaaattggagaatttggagaagaactgaaattttccagatacactagaataaactacacaaaacttgggcccgtctttttttttggtcgttttcagaaggccaaatcaaagtccaaatcgggacccaaatcgggaccctagccaataaacaagccaccgacatctcacgagttctgagccccacttcgtttaacgtgacagcacgctctgggcaaggcgagacgttgtctaatttttcagttatgtgcgttttctgtactgtacagtttaaggaaaaactcacttcattgtattgcccattgagtggctccaactttggaaaaacgcatttgtaataagcatcaaaaatgggagttgacttgtaggcagacaagtttctcgctgtgtcatgtctaacttctcgtggagtccacttgaacacattgagctcattctcattttcatatttctgtgtgtagttgatacagaaattgacgactgtaaatactagtactccgaataaaatccaacgaaaacaactccgcattgtaagtttatcggtgagcctatggttagccatgcctaatcgggagaacgaaaacatcatacagttgaagtagcgaaaatgtgaatcgggggaggcggtatgtacatctacggatgtagcatgatccgaaaacaaagattacggcttgagagaaacatgtcggggagagtcccagcgccatgtaatttctttatttcgagtgcgattggataactaatatttttgagcggtgtagaaataaaacccaaatactggtaaaatgacaagacacggataaaatccaatcgcttgggtttaagtgcttctaacatttttcacctattgggaaaagataagggaatttctcaggacgccaagacatatataaaacgcccatgctatggtac