Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F01G10.1   

sjj_F01G10.1RNAiJA:F01G10.1
PCR_productsjj_F01G10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F01G10.1 Source_evidenceePCR931WS150 Sequence/Annotation Release
Chunk_score Abs_score868
Max_abs_score868F01G10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1024436510245425
Overlaps_transcript F01G10.1.1 Source_evidenceePCR931WS150 Sequence/Annotation Release
F01G10.1.2 Source_evidenceePCR931WS150 Sequence/Annotation Release
WB_DNA_textsjj_F01G10.11061agggaaaaggaatcgaaggaattgaaaacgaggacaattggcatggaaagccagtcccagagggaacagtaagtttgacgtgagaatgaaatagtctcatattaaaaatttcaggtcaatgccatcaaggctagattccacggaagccaaaagggaaagctcgttgctcaaaagccaatcaatgacgcccctgctattgatctccatgttggatccatcaaaatggctgccccagaatacaagaagggagacaaggtcgccacaagagccgcttacggaactgcacttgctaagcttggagatgctagtccacgtgtcattggtcttgatggagataccaagaactctactttctctgacaaacttcttaagaagcacccagatcaattcattgagtgcttcattgccgaacagaatcttgtcggtgtagctgtgggagcgcaatgccgtgaccgcacaattccattcaccagcacattcgctgcattcttcacccgagccactgatcagatccgtatggccgctgtttcatttgctaatctcaaatgcgttggatctcacgtcggagtctcaattggagaagatggaccaagtcaaatggctctcgaagatcttgcaattttccgtactatcccaggagcaactgttttctacccaaccgacgccgtgtctgctgaaagagcaacagagttggctgccaacacaaaaggagttgttttcattcgtaccggccgccccgcacttccagttctctacgacaatgaagagccattccacattggacaagccaaggttgtgaagcagtcagcccaagataaaattgttcttgtcggatcgggagtcactttgtacgagtcattgaaggccgctgaggagttggagaaagaaggtttgttttttttgttacgttttactttttaaagttttattttcaaaaagaaactgtatttgaaactaaaaattatgttttcaggaattcacgccactgttatcgatccattcaccatcaagccactggatggaaagaccatcgccgagcacgctctgaaagttggaggacg