Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F07A5.2   

sjj_F07A5.2RNAiJA:F07A5.2
PCR_productsjj_F07A5.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF07A5.2 Source_evidenceePCR855WS150 Sequence/Annotation Release
Overlaps_Gene F07A5.2 Source_evidenceePCR855WS150 Sequence/Annotation Release
Chunk_score Abs_score772
Max_abs_score772F07A5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI73525587353599
Overlaps_transcriptF07A5.2 Source_evidenceePCR855WS150 Sequence/Annotation Release
WB_DNA_textsjj_F07A5.21042ccgggcatgaaactttctaacaactttgaaaattataaatattacaggcagatactctctcatcacttctctcttcagttggtagttcttatgatggagaatctgattctacattcgtgtcaactggaactactccatcatcaagccgtcgttctcgtcttgattcgttcctttcaactactagttccagtaaatcaagaccaagaattaaaagcaagcttcctcgtagctcgtcgtctggattctcgggaacaggatctgaaagatctatttcaagcaaaagatcgaaaattggaaacacttctgggaaccgtaacaagatttcgcaaagtgctagaagaagacttttgcaagctgaaattgagagtcgacgcaatagatccaacaaatcaccaggttccagtcgtaaaagcattctgaagaaatctccgatgaaaaaaagaagatctctttcgagaaaatctttaccaaagaaggagcatattcctccagttcaaaagtttgcaattatcaagaatccagctgctcgtaatcaaggtgagccctgagattgttttgaaagttcacataattgatcatatttcagttcgtggatttgttgctgaatacgcacaagatccagaatttgaagcttttgagcttttggttgacggaattccatttgttgctctctctctgatgaatgctcatccagatcttcgtggaagattcaaacctgttccaccaccaacaccgatgaagaagcatactccaggtagttttatcttgaatcacctttaactcatttactcatttcaaggtatcaatagcccacgaaaacgtcctttgcgtcgtgaatctatttcttccgttaactcgaaaagtgttcgtttcactgatgagggatcttctttttcgaaaagagctagaaaatcttcatccggagatgtcgattcatcgattcgtgagcttggagagacagtatcggatgccatgagtacgatttttgagtcattgtaataaaaaactatttttttttgcagttgacactggtcgccagtac