Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F07A5.6   

sjj_F07A5.6RNAiJA:F07A5.6
PCR_productsjj_F07A5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF07A5.6 Source_evidenceePCR327WS150 Sequence/Annotation Release
Overlaps_Gene F07A5.6 Source_evidenceePCR327WS150 Sequence/Annotation Release
Chunk_score Abs_score267
Max_abs_score267F07A5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI73672617368430
Overlaps_transcriptF07A5.6 Source_evidenceePCR327WS150 Sequence/Annotation Release
WB_DNA_textsjj_F07A5.61170gaaggttgttgcaaaatagatggattcgtgacggagagaagcgcgacacgtcatttgcatgccacaaagggagcccgaaaaaagagtttaaacaattcgtaaagcctcggagcatcatgtaaaagttacatcattttagaatggaaatatcacaaagaaataagaaacgcagagaaaggtcaaaacttgtggaaacccgcagaataaaatacttgccttcaatttttgtgactgtaacgcgtaaacgctttcgaactgcaaagtacagcagtgaacaatggagtagaccgagacctcgaggttgttgaggtgttgggcttgaacttgaagcgacactctaaaaattatattttccatttaatattcagattaaaggtttaccaaccgttttgtgaatagctgtattgttattttcaatgataattggagcatttggagaataaagagaaggatcaagtccatgagcaattggatcttcagtgtcagagcttgatttgctggtgatctgaaatgaattacccttgtttattcgataaatgtttttcggttctcatgtcgcaaacaccttttttgtttttttttaacatttgaaccatggtcttttaaatcaatttcaaggcttgtccgattcaaatcaaaaggatttccccatataaatatatcagaaatcaaaaatgcacttaaaaaagagttgagtcttattcaagtatctgagcgtgtttttcctattcgtctcaattcggaaatcatcaccacacgcaaagcagcaaaacaactgcaaagaaaacaggaagagattgcatgtctgggaacgcgtgaattataaacaactgctttgggtttttgtcagagttgatgatatggtgaagggcggcaagtggcactgataaattcatactcaatttcccagaatccccagtatccaaaatttcaattttatttcaacttctctgattttctatatttctttttaaaatagaagaaaatctgattatatattgttttgacgatcgtcacgatcttgtgaccaatttccaatttgcctccaaacaagctacagtatccaaaaaatggtggcatgacacagccaacaaaacaatcaaatcagtattgctaacgaaccaaaattttgttcgttttctcattttatcggtgaaaatccaatttttg