Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F07C4.1   

sjj_F07C4.1 RNAi (5)
PCR_productsjj_F07C4.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF07C4.1 Source_evidenceePCR801WS150 Sequence/Annotation Release
Overlaps_Gene F07C4.1 Source_evidenceePCR801WS150 Sequence/Annotation Release
Chunk_score Abs_score738
Max_abs_score738F07C4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV76482537649416
Overlaps_transcriptF07C4.1 Source_evidenceePCR801WS150 Sequence/Annotation Release
WB_DNA_textsjj_F07C4.11164ataatttggtgcttgtcggcattgatataacaagaaaacaaaatcaaaaattgaagtcagtgatatttctcactcgtttcttccatatcctccatgcctcatttttatgaaatttcggatagaatcgcaaaatgtggggttgccagtgttacaattgtcaacacattttttatatttctcactgtatttcatatcaggggaatttctggaacttataaaactatgattattattatggcagtaatgggaattttactttccattttggagttgttggctcgtccatttgtgcataactacaacaaagggtggatatatttcagtctgaattcttggatgaacgttcatgaaggttttctaaaacttacaatgatattctactcaagtttttatattgtaatgttgtctcacatatctgtacagtttttattccgttaccttgttttggtcagcccaaaaactgctaaaaaatttacgggaaagggtatattattttcgttatgtgtttcaatattttttggagttattgatggtgtagcgcttatgatttttggattatcagatgaatattcagatgagtatatgatgtaattattgattcaattcaattcgaatataaaattgtatttcagggtggaaatgttgaacaagtatgagttggccattaaagattttccacgattcatcatagtaatctatgtaagttttttttttgaaaaatatgcaaaatgaattctttacacatcttattgttgagcaatcgtgaatagaaaacagtgtgattgttatctgatccttgtaggaattcccagtttacctataggtcatatatgatggcagttgaaaaatgttgtaaaaattgattaaggtgtaatttatgcaattttggtggctgaaaaaaattttgtattctataaaatttagggagccgacggttcactacgttatcgaaatgtgatgtacttagtgagtgctggagttgacgtcgcaattcagtacctcctaattattttctgcggaatcaaaatgcatttggtcatgaaccaaggattcaaaaatgtttcagtagcgaacaagaagattcacaaacaatttttgcgtgctcttatagtacaaaccattgttcctactgttttgtttgttttccctgcagtctttgtgttg