Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08A8.2   

sjj_F08A8.2RNAiJA:F08A8.2
PCR_productsjj_F08A8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08A8.2 Source_evidenceePCR731WS150 Sequence/Annotation Release
Overlaps_Gene F08A8.2 Source_evidenceePCR731WS150 Sequence/Annotation Release
Chunk_score Abs_score668
Max_abs_score668F08A8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1294342012944581
Overlaps_transcriptF08A8.2 Source_evidenceePCR731WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08A8.21162cgatttccgtcaagagcttccatgaaaaattttgaaaaaataaacctcaaatgtttgccacttttcctttaaacttttctcacaatcaggtaaattcccactttccagagaagtgattggctacgagggtcatcccttcgctctccatgacgctttgtttattccaacccttcagtcacaggctagtgatgaacagcaggagaaatggctcgagagagctcggcgacgagagatcattggatgttatgcgcaaactgagctcggtcacggctcaaatcttaggaatcttgaaacaactgcagtctatgacattgcttcccaggagtttgtactacatactcctacgacaacggcgttgaagtggtggcctggagcacttgggaagagctgtaactatgcattggttgtagctgaactgattataaagagaaataactatggcccccacttttttatggtgcagctgagagatgaaaaaacccatattccactaaaaggcgttaccgtaggagatatcgggcctaaaatgaacttcaatgcggcggataatgggtaccttgggttgaacaacttgagagttccacgaacaaatcttttgatgagacattgcaaagtagaggcggatgggacgtatgtgaagccaccgcatgcaaagatcgggtactctggaatggtgaagatcagaagtcagatggctatggagcaggggttgtttttagcacatgcattgacaattgcagcgaggtattcggcagtgaggaggcaaggacatttggatgataagtgagttgaacagtggtttttattggacataaagtaccacaactattcaaatgttatttgctctatctaggaaacgttttttgtcttcagatttatctttaacctacagggatctctggaaaatttggagcaagttgtgtaattttgtaaaaaattaaaattgcaatggtcactgtcaaaaggtagcatagcatgtaaacgtattcaccttttttttcagattttttcgacaaccaaaaattctgaattcactttgaaatttgaactaaaatccgatgcccaattaatcgttaaccttcaattctaccacccagaaattccaggcaagtcgaagtaaaagtccttgactaccagacccagcagcatcgtctattcccat