Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08A8.6   

sjj_F08A8.6RNAiJA:F08A8.6
PCR_productsjj_F08A8.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08A8.6 Source_evidenceePCR888WS150 Sequence/Annotation Release
Overlaps_Gene F08A8.6 Source_evidenceePCR888WS150 Sequence/Annotation Release
Chunk_score Abs_score847
Max_abs_score847F08A8.6
Specificity_index0.927
Rel_score1
Map_statusUnique_ePCRI1293469712936714
K12B6.7 Chunk_score Abs_score67
Specificity_index0.073
Rel_score0.079
Overlaps_transcriptF08A8.6 Source_evidenceePCR888WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08A8.62018gaacctgagattttgagggaactccaaacttctaaaacctatcatcaatttccagaatggatcgcgatgcattctttcgaggccaatttcaggctgtgcaaaaggccatcacaaaagacgagacacctttaaaaccaaaacacttggaaactatactactaggaacgcacactgaaaagtcatctgcaatattttggagctcagtgaagaagattaagctggaaaatcatcctgtgctcacgtggaaattctgtcttctggttcataaattgcttcgggacggacatccggtggtccccaaagaggcttatagaaatgaaaagcgattcacgcaacttgctcttcattggaaggataagagggactatgggccatgcattgacgcatattgcaagttattacacgatcgagtcattttccaccacaaacgtccatattttcctggaaatctgtttgtgagccctttacaacttgatacaatgggaagagatctgagcagaatgttgagattaactggtgatatgatgcatcagatggactcacttttggcattccaggagaaaggttggtaaagcttctatggtagaaaagtcgcggttttactctgtgtactcacaatttctcacgagtaggtattttctctatcccggaatacccgcttttggcagcaatattctgggatgtgcggtaatttttatgataatctaacttttttttaaatctaaaatagatatagaagtgtagaaaaaagtttgttccatctgaaaataatatttatattctcgccaaaaactttcggaaaggaccggaaaatgtttcatatgatttgaagaacgtagagaaaattatacgttcaagaaatttagaaatagttccaggaaaaattgaggttttaagttgtaattgctcagaacttagttatataatatttatgttgctcgaaaatttccggaaaacaggaaaaaacgttccatctgcaaagaaggcttagaaaatttagaatttgatttcaattttgagtacgccagtcggagcacgcgcttcagcgcgtgcgaacggctggtatatatatacagtgcgtacaagttctatacgccaccctctaaatttatgcctgtggccacgtctgtgcttttaaaaaaatttctgttgatgccattcgattccaaatcttaaaaaacgtataggcccaaattttcatgaccttacctcaataattaaaacaatgttcaataaatcgaaaaattggccgtacaacttctatacgccaccctcgattttttgatgatttttcaaaaatttacaatttttgagaagaagttgaacagcacattaataaatttgagtgaatttcggtgcacagtagcttttcctacaaccatagaacaattttgccccaattcgcagatccatggagtgccaatggcaccagagggcctgaaacgtggactgtatatatatatatgataattatacttattgagtggtaacgcgtatttgaatcgtctttggaattacatggggattcaaaaactcaattgccacacctttgacacttattggtgcatttcagtatatctattgtccaactcatctccacgatgggatcctaatactccacaaggtcaatgcctgatgcttcctctgataagtgtaataatggatacctggccattctttatttatatcgtcagaatgatgtacaatctgcacagtaacgtgtcgccacacgaattggaaggctatcgttcccgatttcagacaattttcgagaaaactaaacaattctacgaagagtgctcaaaacatcagtattttagatgttttgttcaaattccaacatttccattgcatgcacctaacttttttacacagtcagatcttgaatcttatcaaacatatctaattggagaatccaagaaactgactgaaacagtaacaccagcagaagaggtgagattctttatacaacagtaatgttatagcgattcagtgaacacacgtagaagtgggaaaaa