Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08B12.2   

sjj_F08B12.2 RNAi JA:F08B12.2
Simmer:F08B12.2
PCR_productsjj_F08B12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08B12.2 Source_evidenceePCR920WS150 Sequence/Annotation Release
Overlaps_Gene F08B12.2 Source_evidenceePCR925WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRX1139343511394498
Overlaps_transcriptF08B12.2 Source_evidenceePCR925WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08B12.21064caaaaacatttctttcggttcaccgaaactttgatgaatactacatcatattcgatctcattttgcaaaaccactatttgagaaactatggtacgttttttaattccaatttttcacctaaagataatgtgtttcaggagcgtcgttcacggaaaacttttattctatgaagcgaatagcatcaggcacaggaaatccaccgaacgatggtagggaaagaataatgtcgcttattacattagtcggatggccttatgtagagaataaattgaatcagctttatgacaggctcaaggaagtttacgaatgcagaagctggtcatcaattaatgtatgtatagacaaataaatttgaaatatcgtttataattccagggcatgaaagcaaagtgtcaaaaaatgtttgtgatcatttggccatacatcaagacagctcttaaggcagtgaaaagtgctctacaacttgcatacattttgaaccgcagctccattcactcgccatggctttacttctcaggcgtgattctgaaacatcttacgccagaagacttggaagctttcaatgctgttcctcttcatctccaaactgggtatcaaatttctagaggaacattaaacgaacatattcatttaagattcttcaatcgcatctggagatttattttgggactacctggaatcgtttcaaggctctttgcttatgggctcttctttgtacagtttttggattatatgtacaacacagatttggcaaaacttacaaagactggccttgacggagctattccttcacctccacacaaaatgatcatatctgaatcggaaattttgagtttggacaccaataaatgcccaatttgtttgaagaaaagagttaatgatactgcgctttttgtatctggatatgtattctgctacacatgtatcaaccaatacgtaaacacttataacaagtgagttttctttattttaaactatcaattatttgagaaaaatttcagatgtccagtgacaggatgcccggcaaacgttcagcatttaatccgtttgtttgtatagcgcta