Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08B6.5   

sjj_F08B6.5RNAiJA:F08B6.5
PCR_productsjj_F08B6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C37A2.5a Source_evidenceePCR860WS150 Sequence/Annotation Release
C37A2.5b Source_evidenceePCR860WS150 Sequence/Annotation Release
Overlaps_Gene C37A2.5 Source_evidenceePCR874WS150 Sequence/Annotation Release
Chunk_score Abs_score790
Max_abs_score790C37A2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI67745036775555
Overlaps_transcript C37A2.5a Source_evidenceePCR874WS150 Sequence/Annotation Release
C37A2.5b Source_evidenceePCR874WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08B6.51053attgatttgaacgatcattttggtggtagttgtggaacacccgggaatccaggaacaccttgtaccatgtgtggcattcccatcatcatcattaacaattcttgatttgccatttgtggtgcctgaaaataatggtttgagagtttaagctttcagaaatagtataaatgtaccattcctctctgcatttgcatttgcatctgctgtattatttgatgttgtgcagccgcttgttgctgttgctgttgctgttgttgctgctgttgtaatagaatactttgcggcgttcctgaatattaacaaatttaaagctatcttaaattgagtttaaaaacctggctgcatcatctgtggaggaaggaattgtcgttgcggtgtgactactccagtagtactcacactttcagatggcgtctttggtgtagccgactgttgtcgttgctggttctcgcgagatttcgccagttcatggatcttgtgggaatctgatacggatatggtttgtcgagacggtgtccgtgacatttgttgttgttgtgacatcgcaacagcaattcgttgctgatccatcattgcagccatttgtggattcatcattgctggatgaaatggaggaggaataaagacgcctgccattggatgagcttgaatcattgttggtggttgggctgaagatgatgatggagcagttgataatgatggattatggggtggctggagttggtttactgaaaattttctgattttgtgatatcgatacactcagattttctctagaatttatgagattataatgaagaaaaaacaaacgtttctgttgttgttgctgttgctgcttattcttctcggctagcgcattcgccaccatcgacggattgatgccaattttcgcagaaactggggtggctggcgtagatcgttgagcgccaactggtggtacaactgacgtggtagccgaagttgttgaagatgaaacctgagcgattcccataagtgttgcgacagctgatgaagccgacgatgacggagttttcaagacaagatcagtgggtt