Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08G2.2   

sjj_F08G2.2RNAiSimmer:F08G2.2
PCR_productsjj_F08G2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK131.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
F08G2.2 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (12)
Overlaps_transcript ZK131.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
F08G2.2 Source_evidenceePCR384WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08G2.2820taggaatgaatccgtctcaaaaagttttgcaattatttctgtaaatgtgctcgtttaaaaaaaacaacttcaggccgcgttatacaataaatttatccaacaagtgccaaattcactgctattgcaattttcaaagaaggaaacgttatctgcagctcaagattacccgaattcagatatttcgacgtcacaattagtaatcgttcctgatgatactggtgactattctaaattttagatacgaatttcttaattttcagtttttcaggtaatattatggcaatgcaaaacatgtttgataagatttattcagtttataataggatttataacatttgtggccctaaagagggccgttgggttcggttaggtgtgttgaaggatgcctattccttatctccaccggtcttctttggaagaagaacagcttggatgttcggaagaactcctccttgagcgattgtgactccagccaaaagtttgttcaactcttcgtcattacggacggcaagttgaagatgtcttggggcgatacgggtcttcttgttatcacgggcagcgttaccggccaactcgagaacctcagcagcgaggtattcgagaacagcggccaagtagactggggctccggctccgacgcgttgagcgtagtttcctttgcgaagaatacggtgaagacgaccaactgggaattggagtccggctcttgatgagcgggacttggcctttcctccggtcttggctttgcctccctttccacgtccagacattgtttgattgatagaatcgaatctgatgaggcaactgcagagacactatt