Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08G2.5   

sjj_F08G2.5RNAiJA:F08G2.5
PCR_productsjj_F08G2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08G2.5 Source_evidenceePCR537WS150 Sequence/Annotation Release
Overlaps_Gene F08G2.5 Source_evidenceePCR537WS150 Sequence/Annotation Release
Chunk_score Abs_score516
Max_abs_score516F08G2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1383280213833657
Overlaps_transcriptF08G2.5 Source_evidenceePCR537WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08G2.5856acttaaatggtcatatcccggttgttttaagatttatcgaaaaactaccaacaaacaaaatattgctgatgcctttttcaataattttgtagttgaacacttttcgatatcacttatttaaaccaagatataggataccaaaaatgaaatagaatacaattaaactaaaaacaaatatttacatttaaaaattcaagctccattcgaataagtttctctcggcgagttctcacaatcatagatcccgcgacgacgattgcggtatggttcccacgttccatttcttccatacggatgccatcgtctcccatgacgctgctcccactcggcaagcccatctcgacaacggcatggcgaggagtcactggaattggttgatgatttagaactcaccgagtcatcggaagaagaggacgaggaagaatcatcagagtcatcagaagagtcgtcagacgaagtgttcggaggtttcaccgactttctcttcgatctctgtttacgagctcgtcgagctcgtggagctggagattcagagatcggaagttccgaagaacgtggatattgacacccttgggtgtctctacgatcttgagaagttaacgtggaaaccgtggagtcggaatatctatcttcatcgtccttatctgaaagttcagattctgaactatcagatgacgagtcgaagaatccgtctccaagaggaagtggacgagtgctgagctttctcattgtaaatgagatgctcttcaaggtgagaggtgctggttttataggtgggttttgttgacgaatagtttcgaattatttcgaagagtttcgaaattagtcatgactttgataaggtgggcaaatattg