Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F08G2.7   

sjj_F08G2.7 RNAi JA:F08G2.7
[cgc5655]:F08G2.7
PCR_productsjj_F08G2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08G2.7 Source_evidenceePCR707WS150 Sequence/Annotation Release
Overlaps_Gene F08G2.7 Source_evidenceePCR707WS150 Sequence/Annotation Release
Chunk_score Abs_score707
Max_abs_score707F08G2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1383764813838757
Overlaps_transcriptF08G2.7 Source_evidenceePCR707WS150 Sequence/Annotation Release
WB_DNA_textsjj_F08G2.71110ttttcgctgcaccatctagtattgccagtaggcgttaaatacctgcctgcctgcctgaccataaggcgacctccgcctgcctctcgcctcaatccgtgccttatgctaaaacatatgtgaactttttttaaaaattgcttaattagattttcattttaaaaaaaagtaaaaattcaaaaaagaagcgaaagacaggcgtttggcgggcaggtttcaggcaggcggcaggccctcagaaaatttcagcaaaaaattcaaactcaccagctcccccatgagtcgtatccattccagacgttgttggagtgttcgaagaggaaatcggatgcataggtgcccccatgaaagagtacctctgcgcggagcccccagaattcggctgaaactggaacatctgcgggaattgtggagtggccggtgggaatccgaactggggcattatgggatttccaaacgggattttatgctcagcttcttgccatttccgcttaaaatactcggttttcttcttctccttatccagcttcgcattcgactgtaacaacattttcacgaggtcatccttctccttctcgagctctttaatctgccgatggtcgtttctctgcgttctctcataattaaacagtctctcctcgtagtgagctcgaattttcttcttcaaatcctgatatctcatcgatttcttatagacctcctcttcatcctcctcctcgtcctcctcctcttccggatggtgccgccgatgctgatagtgccggtgatagccgatcggcgacgtgttctcacttccgtactctgacgtctcccactgttgatacctgggcgctgctcgggaagagcttgatgacgtcattttcgaggtggattgcaccatgttgctgctccgccggcgttgatctcgtggctcgcggcggaatgagtcgacgttgaaggagcggctgctgcttggggcttcttcctcgatatatctgcaaatttgagattaaggattttttgatacatggccgaatctaaaatgtatcggtggcctagttttcctggtttccaggtttctaggccacgtaagaaaattcagcatacgataggcttcttccttatacccttgaa