Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F09G2.4   

sjj_F09G2.4 RNAi JA:F09G2.4
Simmer:F09G2.4
PF:GL1_4B6
PCR_productsjj_F09G2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF09G2.4 Source_evidenceePCR1066WS150 Sequence/Annotation Release
Overlaps_Gene F09G2.4 Source_evidenceePCR1066WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV71825437183721
Overlaps_transcriptF09G2.4 Source_evidenceePCR1066WS150 Sequence/Annotation Release
WB_DNA_textsjj_F09G2.41179accggagctcatcacatttcacttccgcaaatgcgacgaaaagatcgagacgagcagttggtgacgaaaattttacgaacagtacgtcaaaaaggagattgtatgattgtaatcgatacagctggaagagttctcgagctggcgcatcttttagatcaattatggtccaagtaagttattcttttaatttgaaataaaaattattaaaaataaaaatttcagcgctgatgcaggtctatccacgtataatctcgtcatgatgtcacatgtagcatcttcagttgttcaattcgcaaaatctcaattagaatggatgaatgagaagcttttcaaatatgattccagctcagcccgttacaatcctttcacactgaaacatgtcacactctgtcattcacatcaggaattgatgagggttagatctccgaaagttgtgttgtgcagtagtcaggatatggaatcaggattttctagagaattattcctcgattggtgttctgatccaagaaacggtgtgattttaacggcacgtccagcttcattcactcttgctgcaaagcttgtcaatatggctgaaagagcaaatgatggtgttctgaaacacgaagatcgattgattagtttagttgtgaagaagagagttgcactggaaggagaagaacttttggaatataaacgaagaaaagctgaaagagatgcagaagaaactagacttcgaatggaaagagctagacgacaggcacaggcaaatgagagtgatgacagtgatgatgatgatattgctgctccaattgttccaaggcattcggaaaaagatttccgttcgtttgatggctcggaaaatgatgcgcatacttttgatattatggcgaaatgggataatcaacaaaagtttgttttataaaagttttatacgtttgatttgtctttaatttaattttttaattttcagagcatcattcttcaagacaactaaaaaatcatttccaatgtttccttatatcgaagaaaaagtcaagtgggatgattatggagaagttattaaaccagaagactacactgtgatttcaaaaattgatttacggaaaggacaaaataaagatgaaccggtagttgtgaagaaacgagaagaagaagaagaagtttataatccgaacgatcatgttgaagaaatgccga