Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10A3.11   

sjj_F10A3.11 RNAi (5)
PCR_productsjj_F10A3.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10A3.11 Source_evidenceePCR787WS150 Sequence/Annotation Release
Overlaps_Gene F10A3.11 Source_evidenceePCR787WS150 Sequence/Annotation Release
Chunk_score Abs_score695
Max_abs_score695F10A3.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1616523116166312
Overlaps_transcriptF10A3.11 Source_evidenceePCR787WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10A3.111082gccactgaatttttgttgaaaactccattcattcacagaatgttgttaatcctacttttaattcatctcccaagcttttcaactttcgaaagttcattcaaaatgatacgggtatttggaagaccagttgagttgagcgggacagttgagtttaacttgtcaattgatgagtgcactgacaactgctatgatgacgacaactgctcggtaaggagaattgaagtagtacatacatataatgttgccgtttcattatattttcagctatcttattacattcactcaaagtgttatcaatacaactatggcacaatgaacatccaagttttggataaatctactgaggacaaggtgtcgtttaagttaagttagtcaggcacggtcaggcacatacccctgaaatcgtgcctgcccacttcaatacattatttggagctccgtttttaaagttttcagataattaccaacggatgccccagaacaaatcctctagccggaactggtatcgtagcaaatgacaaatggattgatgaagcaggtggtcatgagaatataatcagttcagatggaaacatttggagtgttgaatacaataagtttgtctgcacaaatggaactcgtatgtttctaagaaactccacatttgtatgcatcggtgttcggtttttcgttgataaaacatgtgctgcccatgattatgcagtgaacttctgcgtttcggaaggattcgaaagtattacaggcccattccagccaagtgaattggaatttttgttaggtaactctctatgactttactgtcagtactcgtatatcgccaaagttcagaagatcgcacaagagcagccaaggaatacggtgacgtcggaaattatcaatcctatgtgtggattgacggtaaaaatggcaagtatcaggacccagctctacaggcaagctacaattccgatgtgatgtgcgcatatgctgatcattcaaattgtgcgtatttcggtgacaaatcgtgcccatctgttgattcgtacgggtaagtaatattatattagtaatttttgaaaataattctgctttcagatgcacaa