Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10B5.5   

sjj_F10B5.5 RNAi JA:F10B5.5
PF:GL1_3D5
PCR_productsjj_F10B5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10B5.5 Source_evidenceePCR704WS150 Sequence/Annotation Release
Overlaps_Gene F10B5.5 Source_evidenceePCR704WS150 Sequence/Annotation Release
Chunk_score Abs_score641
Max_abs_score641F10B5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII81589118159713
Overlaps_transcriptF10B5.5 Source_evidenceePCR704WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10B5.5803aactggaccaccaggaacagggaaaacttctttatgcaaaggacttgcccagcatttatcaattcgaatgaacgataaatattcaaaatctgtaatgttggaaatcaatagtcatagcctgttttcaaaatggttctcagaaagtggaaaactcgttcaaaaaatgttcgatcaaattgatgaactagctgaagatgagaagtgcatggtttttgttcttatcgacgaggtttgatttttttaaaaaacaatttttctggttttcatcagtttttatgtcaggttgaatcgctcggaatgtgtcgtgaatcctcatcatctcgttctgaaccatcggacgccattcgagcagtcaacgcccttctcactcaaattgatagaatcaggagacgtgataacgtacttattctgtgtacgtcgaacctggaatcaactctggataaagctctcgttgatcgagccgacattgtaaaaaatgtcgggcagccttcggactttgcacgatattctatgctgaaatcatcaattatggaattggcccggattggtgttgttattgataatgaagttcacactgattattggccacaagatatttgtgatgtgagtttaacacaaatgtttcgaaataattgtcaactgtttacagacgaaagcaccaagaaatgagtttaccgagattctttttaaaatcgcccaagaagcgcgtggactctctggacgagcaatatccatgcttcctacactggtttattcaaaaagtccggaagaaactatcacactgccgaattgcatgaatctct