Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10B5.6   

sjj_F10B5.6 RNAi JA:F10B5.6
Simmer:F10B5.6
PF:GL1_4G9
PCR_productsjj_F10B5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F10B5.6 Source_evidenceePCR950WS150 Sequence/Annotation Release
Chunk_score Abs_score866
Max_abs_score866F10B5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII81603218161409
Overlaps_transcript F10B5.6.2 Source_evidenceePCR950WS150 Sequence/Annotation Release
F10B5.6.1 Source_evidenceePCR950WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10B5.61089ttgcttcattcagccttccttgccgtctggctatgtggccaatgttattgagcattgggtgccaaaagtcgtcgattttcctgaaaaaatgttatttttctctcaaataatcatcgaattagatacttactttttcaagacttcttcaattggaatgatttcatcggtctctgtaaccatatacaaaacagttctgaataaaatatcggcttccgcgtaactttttgcagtataggctacacaagcttcttcgtgacgaatcagagggtcattcggtgcccgagcaactgcttctcccatgaacttcttgctcagcttctgactatgcgtactgtactgaagagaagtgtacaagaacggttcagaacttttatccacaagtttcgacgctctgtaatagcaactcatggactgttcgtgttcaacttcatagtgaagaatatgaccaaaagccacccatccttcagcaaacgtcgaatccatcatcgtgcatttacctaaagaagctctatttaaacctcaatgaaatgggaaacatactgatgaaatttcgagctcttgagtttgctccaatactataataatacatagcaacacaataccatggaagtggaatatgaggatcatcactaactagttgatgacctaattcaagcagagatcgagaatcctttaacattgttaggcagtgaatacgaagaataatgcactcaggatgtggtccaaatagatcaaatagctcgtcagtgattttttttgtttctcgaaatcgacccatctcgtaggcacgttgagcacgttccataagaattcgtggatcatgatttccttcgtgtaacttcagctgttcatttctgacttttctgtacttctcccacatcgcaggctcaaccagattgtattttgccattaatcgttcgacatggagagttgtattatcctgaaataataaaacacggtcaaatcatgtataaaagatgacttacaagactcagcgcgtaattaatacaaatcattgcagcatcacgattcatcaatttcaaaaaactttctgctatggttatcataagagctggaaccattctgagc