Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10C2.3   

sjj_F10C2.3RNAiJA:F10C2.3
PCR_productsjj_F10C2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10C2.3 Source_evidenceePCR875WS150 Sequence/Annotation Release
Overlaps_Gene F10C2.3 Source_evidenceePCR875WS150 Sequence/Annotation Release
Chunk_score Abs_score791
Max_abs_score791F10C2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1202472512025729
Overlaps_transcriptF10C2.3 Source_evidenceePCR875WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10C2.31005tgtgattgttctcgactcggtctcacactccaatttccggcggacaatgaataaaacactagatgtgatgcattctctttatggatcatttatatttgatggaatgacaaaaattggcgataattctttttcgaatgctgttggcttttttgccggaaaatggtggaataccgagttcggagatgcccatggatattttgatgatcatgatttgatatggaaacattatcgagaaaacggttatcgtacactgtacgcagaggattatccaggatttaatttgttcaattatttatcaaaaggattcaaaaagaaaccagtggatcattattttaggccatattggttgaacgtctattggacatatgttcatcgaagaagtagaaatctatgttatggaaaccatagaatgcataatttacaactaaactatttatcacaatttgtatcaaagtacaaaggtaatccaaaataataaatcaatttcactagatacttcagaccaaccaaaatttgcgatctcttggcttactgaacttggacacgactggttgaatcaagttcgttatggagatgaagatctcgcgaatttcttgaagaagcacgttgaggatctcgagaattcttacctttttattatgtcggatcacggtcatagatttgataatattagaaaaacgagcatcggaaggttagaagaacgacttccatttttttcggtttcattaccgaaaaagttgaggaaagattcaaagttggtggatactgttagaaagaactcaaaggtatggtaatcgatttagggaaaattagattatttgagataattccagaaactgacatcattttttgatgtttatgcaacttttcggcatattcttaacaattcaaaacagccagatgttatgaggggtgaaagtctgtttcttcccataaaggttagagttgaaatctttttttgatttaaaacttagttttaggaccgaaattgtgaaaccgcacaca