Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10D11.2   

sjj_F10D11.2 RNAi JA:F10D11.2
PF:GL1_1F10
PCR_productsjj_F10D11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10D11.2 Source_evidenceePCR737WS150 Sequence/Annotation Release
Overlaps_Gene F10D11.2 Source_evidenceePCR767WS150 Sequence/Annotation Release
Chunk_score Abs_score641
Max_abs_score641F10D11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84375118438659
Overlaps_transcriptF10D11.2 Source_evidenceePCR767WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10D11.21149tatctcactgtttgtgccgcttcatcacgctcccgttctaattcttcttccaaaatctgaaaatttaatttttcataccgaactcagattaaaatctataccttttcatcagctttctgtactgtcattgtgttttttagaaaatctctgacagacattcctgctcctgaatttccagttgtatccatcttttccggagatattgatcgatttcgaatcggtgaatgaagatttgcaggttcatgtgaaatgggaactggataaactggcattggattatttattggctgctgaaacggttttgattggaaaaaatattcgaaataacgcttacctgattcacagtaacttcgttttgaccgaaagtatcattttcaattttttcttcgatttcttcttgaacaggaggatccatgtcatctattgaattatcttcaggttgatgtggacttgtcattcgaggagacggaatacgaccctgtagaaaagaagcaaaagtctaatggatattaataatatctaatttgaaacaaatgaaatatttaaaagaaattatgttccaatgtagattaaggaaaatattggaaaaagtaataacttaccagacatttctcaaggattagtttgttcaaactttgctgtgactgaataaactgatgaacaacttccgataaatcatcaattttcttttcaatttcagcttgtttttcataatgtggagtcatcaaatctgcgaaaaactgtcttttcttatcgtcgctgccactggaagtttggggattcaaaaggtccaatatttgcagatgattctaaaaaaaatatcgattttttcgactttcggaacttttaaagtttactgttaatgaattcgactctgtaacatagttcgcagcagatggttgagcagcacttgagttgaatcccatttgatactggaaaattatcgattttcaataaatacgaaaaaggaaactcttgaaaatgaacaatcgaagaacttacaatagttttatcagaaataggaaagttcagctgaggattcatttcaaaaacttgtaaatccgtcattgatagttatcctgcaaggaatattagtttaaacaaataccagatgaaatgtaaatttacgataaataaggcgcgtatgcg