Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10D11.6   

sjj_F10D11.6RNAiJA:F10D11.6
PCR_productsjj_F10D11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10D11.6 Source_evidenceePCR793WS150 Sequence/Annotation Release
Overlaps_Gene F10D11.6 Source_evidenceePCR793WS150 Sequence/Annotation Release
Chunk_score Abs_score751
Max_abs_score751F10D11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI84465088447644
Overlaps_transcriptF10D11.6 Source_evidenceePCR793WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10D11.61137gaatgacagatggagcacgaacagttctgatttgaacggcaattttctggtttggatatttttcacggacagctggaaggatatctccaaaacagattccgaggtcggcaagtcctgaaaaaaattatgtaatgaaaatgttggtatgatttttcagttgaattcatactgaatttttgaaaccaaaaaaaagatctttaaaaattttatgtactgcaactctggtgcagttaaatgttgacctgaggccaccaggtagataaataaggaatttaaaattgcaatagttttcctctataatacattcacacttaccagcagtgtcttcttggcgtcttcttcttgaatctctctttctctttgttctcaactttgtcgtttcatttgtagctgccacaattgctgggcttgatgtatggcttgcaacgtgtctacttggtctgattgacataacaaacgtggcatttgaatgaactcctcttctcaatcgatattttgctttttcctttgccaatcgtcttcttcttcgagcttcttcttcgtctaattccacttcagtagcctccaaatcatcttcatcatctgagcaagtagtcttcaaaagttctccaatctttggggtctctggtccaattcggaatgataaaaattgtttgcgatgaagccagtagaagagggaattaacagtgtaatcagttacaataaactcagccatttgacctccataatatgggaattgagttgggaatggtccgaatggtgttccaccttgtccgtatggagagaattccccagtcaaatcaattgaataatcattagaagttgcataagattgaatatattgaagagaaagatacaaatcgtttagtttgctcatgtcgagatgaccagcaatttggcgaaggaaagatgctggatcatcaccacctccaccagctgcagagcattttgagcaatctggaggaggttgaactgcaactgggcctccagcaatctgaaaattacttaattgctgaataaactgtattttcagtattattcttgcattccaagcaggcctgaatccgaaaaagaaagttctgaaacttgtttttcgaacagaatatttatcattaccgcttggaccgcattacagtt