Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10E7.6   

sjj_F10E7.6RNAiJA:F10E7.6
PCR_productsjj_F10E7.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10E7.6 Source_evidenceePCR462WS150 Sequence/Annotation Release
Overlaps_Gene F10E7.5 Source_evidenceePCR43WS150 Sequence/Annotation Release
F10E7.6 (3)
Overlaps_transcript F10E7.6 Source_evidenceePCR462WS150 Sequence/Annotation Release
F10E7.5 Source_evidenceePCR43WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10E7.6698tccgaaaattgtcgtttatcatcttgtttttttgtttatccaataaattgttacttgtttcagagtattaatattgataaatatagaaggaggttaaatcccaaacttattaaatatccaatgatgattataaaccaacgagaaagctgattgttcaggaacatgtggagggttttgttatctcgttcctcaatattagctcaagccagaggattggcaaccaagagaaacgcacctgaaccgaagtttacacaaagtgccgcatttcaagtaattacctcgaagcataaataattattttagtagatgtctttcagggtcgtggatctcgaggaatgccacaattcaagccagattactactcatcagacgcgtatgccaacaaaaaagtgctatcagctatcggaagtcttatagcaattgtaatctatttcggttggctcagagaaccatcagatttggacgaaatatggagcgctccaccacacattttgacctccaatttggagagaaaaatgcttcgagaacaaattaagcaagctcaagagaagggaatggatacagcgcttctacgagcacaattggagtatgtggatgttaaggaagaagccttgcgaattcaattcgagcagaagacaaatcaactggctagaagaaatcaacaatcataagttaatttcctctgttcgactaggtcc