Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F10E9.5   

sjj_F10E9.5 RNAi JA:F10E9.5
Simmer:F10E9.5:Repeat_a
Simmer:F10E9.5:Screen
PCR_productsjj_F10E9.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10E9.5 Source_evidenceePCR482WS150 Sequence/Annotation Release
Overlaps_Gene F10E9.5 Source_evidenceePCR482WS150 Sequence/Annotation Release
Chunk_score Abs_score419
Max_abs_score419F10E9.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII83076078308394
Overlaps_transcriptF10E9.5 Source_evidenceePCR482WS150 Sequence/Annotation Release
WB_DNA_textsjj_F10E9.5788gagatcctgcattcaatcatttctggagacactatgacttttcgaatcaatggataaagcaacatacagatgcatcacgtcaaggtaattggttagcttctgttcttaaaatgttgtatattttcagttcaaatgcaaatggtccagagagataatctttcgactgaacaatgttttagtgactctgaagagccggaagtgatcgaaagactttctcggtgtgaaatatatagtgaaattgagaatgaagaatcagatattgaagaaatgagtgaagagatgaaagcattttttgcaaaaacacaagaacatcgtcaaaagtgtaagtttaatcggaattagacgaatatttgttttaaataactttgtttatttcagtaaaagaacaaagagcggcagaaaaacggaaagaagggcaatcaagttcaaaaagtcaagaggaatacgttaacgttgataaaagtaagaaaattggtttatttaacggtttgataaattttaatgggcatttttagttagtatacgtgggcgtatagagcaatcaacggatcaccgaaacgccagcgccgaattcatagcaaaaagagagaaagcgaaaaaagattacggagaatcagcgacaaagattctagcaatggaaagtacattggcaatgaagtttgaatccgaatattcacaaaatcctcagctctggcctaatattccattcagattttgactattctttatatgaagctaaaagcatttttcgtgtctactgtatttgtttttatgcactggttttcgag