Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F11A3.2   

sjj_F11A3.2 RNAi JA:F11A3.2
Simmer:F11A3.2
PF:GL1_7B8
PCR_productsjj_F11A3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F11A3.2a Source_evidenceePCR958WS150 Sequence/Annotation Release
F11A3.2b Source_evidenceePCR958WS150 Sequence/Annotation Release
Overlaps_Gene F11A3.2 (3)
Overlaps_transcript F11A3.2b Source_evidenceePCR958WS150 Sequence/Annotation Release
F11A3.2a Source_evidenceePCR958WS150 Sequence/Annotation Release
WB_DNA_textsjj_F11A3.21142ataaccagcaagtggttccgccaacaactgcagaagagccagctcaaggtgaagacaaaaatcagtatcacgtaagtgtttcataagaattttaagcaataaatctaataattttcagaaagacgtgactgctgaagataaaaaagcgagaaaagcagccaaggcagctgagaaaaaagcgagaggtatcttatttatctttttttcctaaaaaataaattaattttttcagctgaaaaatctgtagccaataaagccgccgccgccgctgggagcactcaaaatcaagggcaaaagaaggaaaaaccgccaaaagagcattcagcagttccatctgaatccactactaaacttatcgaagaaaatgcacagctcacgaaaaccacagaacagcttgcagcgaaaatggaaaccttggtgattgaagatgtgaagattaatggaagtctaaagccggcgataaagaaatctactggtgttgagaaaaatgttcgacatgttcataacgttataatgccttctgtggtcacatttggtgagtttttgataatttaatttattagatttgttcttttgaagatcttccaaaaaatcaaacgaaaacgttgccgtctgcatctgattctgacgaagcagtagcatcagaaattgaatcaacagcaatcgcccaattggatgatgcgacgtcttttgtacacattcatcctgcattcttaacgcttatggctaaagcagaattggaaaaaattccagatgttgaaacagtttgtattcaatttattgctgctttcaaagaggtaaaatattatttttcaatcaaactgtataattattttattttagtttctgcgagattggacagtagaacgagaaaagaataatatcaatgcttccacattcggtcacgacctcgatttggctattcgtccacaacttgctcatatgactcaaaatggtcactggccattgccatttgcacttgggaatacagttcgattgttgaaaagaacaatcaaacgacttgaggaaagcactaatatgaagtgtgaagaagaattacaagtttatctggaagatactttggctataaatttctgtcacgcgtacaaagccatcagtcaactgcttgttcgcaaaattca