Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F11A5.1   

sjj_F11A5.1RNAiJA:F11A5.1
PCR_productsjj_F11A5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF11A5.1 Source_evidenceePCR1029WS150 Sequence/Annotation Release
Overlaps_Gene F11A5.1 Source_evidenceePCR1029WS150 Sequence/Annotation Release
Chunk_score Abs_score945
Max_abs_score945F11A5.1
Specificity_index0.706
Rel_score1
Map_statusUnique_ePCRV1619324916194946
F11A5.2 Chunk_score Abs_score328
Specificity_index0.245
Rel_score0.347
K05D4.7 Chunk_score Abs_score65
Specificity_index0.049
Rel_score0.069
Overlaps_transcriptF11A5.1 Source_evidenceePCR1029WS150 Sequence/Annotation Release
WB_DNA_textsjj_F11A5.11698agaaaccaatacccgtgcaggtgaaacttacttcttattgaatgctgaaatgtgaaatttattcattttattcgtcgcccagaaaatttaaatatttgtcaacgatcactttttactgaaaatggaaggtgaatcatttttcgcgagccctcaattcttctccctaaccttgtatacaatcggactcttctcttttcctattaatttattcggtgcttattgcattgtattccaaactcctgaatccatgaaatccgtcaaatggagcatgttcaatatgcatttctggagttcctttgaagatataacagtcagtttattagttcaaccgtatctattaaaatccacttgggcgggaattccatatggaattttgaaggagtttcatgtcccattaactcttcaagcctatattctttccacctcgctttgcagtaagttttttttgcttacagttttacaatgtaaaaaaaaactgtagtttcgtgaatataagccccaaaagcaaacttcaaactaggtagacctgtaattcatcgttctataatagttttagtgtttcatagtaccttgaaacagaatctcattatagtgcttgctgtctcaatcatcaccatcttcgaaaaccgttacttccttctattcgccgaacacacttggtggcggtttgctcgtcgaccattccttgccattaactacaccctcgccattctctactacgtcccaaccgtgctcagcgcgccagatcaaaccagtgcccgagctgtaactttcaaagaattccccgaatttcggaagctagacaccccggaaaacccgatatatgttctggttttggataacccatgggtttcggcaagacagattgcaatggaagtgacatacttaacagaggcgttgagtttagtttttctgctgaagtataacatgaaaaacgcgacgaaaggggtgaaaatgtcagagaacacttcaagattgcaaaaagcttttttgaaagccctgtatactcaggtaagtatcaaggctgtgcggcaaccgagattttcggcaactggcaattgccgacgttgccgaaccttaaaaatttcggcaaccggcaattgccgatgttgccgaacccgaaaaatttcggcaaccggcaattgtcgaagttgccgaacccaaaaaatttcggcaaccggcaattgccgatgttgccgaacccgaaaaatttcggcacccggcaactttttgttgccgaaaattcggcaacttttcggcaaccggcaaccaggtttcaaagtttttactaagtatgtctttaaaaaagtctaaaaactatccgaaaattttttttagacctccctcccgttcatggtgatcctggttccatctgttgtatcaattttttctggaattctagaaatctcaacgcaaagtgtgaataatcttgtgtatattacactttcctgccatggattggcgtctaccaccgttatgctattaattcaaaaaccatatcgagaattttgtttaggaatagtcggaaagtcaaaacggcgacagaaaatcactgccatatcgacaataagtcgaagatctgttgtgactgctttttaatttttttttaaatttagtttagtagcgtcttgtcttgaaaaaatgtttatttcttaaaaaatagcgttgagaaaactattcaagaattcgctttcggat